ZFIN ID: ZDB-ALT-020625-2
Genomic Feature: e713
Synonyms:
Affected Genomic Regions: pou5f3
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: Brand Lab
Location: Chr 21: 13687101 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Leu>Pro (1)
FLANKING SEQUENCE (GENOMIC)
ATAATAAGCATGGCTGATTTGATCCATAGCTTGGCTTGGAGCTTTTCTATAAACTTTAGTGAGCACCTGGAGCAAGTTAGCTGGTGAGATGACCCACCAAACCAGGGTGCAAGCCGTTTTTGAAGACATCTGGTCGGTGGAGGGATGGCATGTATAAGGCAGGGGCTCCTCCAGGATGGGCTGGTCCAGGATAGCCTTGACCTGGGAGCACAGTGCCACCCATGTGGGGTGGAGGTGGTGGACTCTGCTCGTAATACTGTGCTTCAACACACTCGTCATCAAAGGGCAAAGCTAGACGCTTTCCCTTCTGTCTACGGTTGCAGAACCATACACGCACTACCTAGAGAAAAGCACATTGTTAAAGTCAAACAGCTTCTAGAAGGTGAAAAATGCTTCACAGACTTTGAGGCGTGCTTACATCTCTCTCCAGGCCTAGATCATCGGATATGTGCGTTATCTCCAGAGTGTTGGGTTTGGGGCACTTCACGAAGTACGACTCT
A/G
GAGCAGAACGGACTGTGCCTTCCAAGCTGGTCCTTCGTTTTCTTTTTCGCGTGTCGACAAACACCCGTTCAATTTTGTACATCTGAAAGATAAATTGAAATAACATTAAGCTCAAAATTAAGCTTGTTTGACATAAATCTTTTGATAAAACCAAAGGTTAAGAGTAACAAATAAATTTTTTGCAAGTACATGGAATCATTTATGTTGTTGGCCAATCAATGCAATAAGTGGTCATTTGTTTTAGATTATAGCCTGTACAACAAATATACTTGATATGCTAGTGTGAAGATTTGTTTTCTCGTGTGAGAAAATGTAGACCACTCAACATTGTCATACACTTAAGAGTATTATACCAAAACATTTTTTCACAGTTTGTGTTTGATGTGCATAAGGGTTTCATTATGAGACATTCAACCTCCACACTAAAAATTGAATGGTGACTTTAAATGTATTTTACAACTGCTAAATGTCAAGAGTTCAGATGCAAAAACCTCTAAATG
(1)
Comment Citation
The m216 and e713 alleles show the same base change. Burgess et al., 2002
OTHER e713 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous pou5f3e713/e713 pou5f3 Unknown

CITATIONS  (5)