ZFIN ID: ZDB-ALT-020514-4
Genomic Feature: s399
Synonyms:
Affected Genomic Regions: rx3
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stainier Lab
Location: Chr 21: 10757057 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation: Tyr>Stop at position 130 (1)
FLANKING SEQUENCE (GENOMIC)
CTTTTTTTATTTAGCTCTTACAATTTAAGTAATTAGTATAATAGGCTATATTTATATATCTACGTTTTATGCACGTGTGTTTAGTACATTTTAGATTTCAGTGTTTAAAAAGTAGGTTAAATTTTTTTTTTTTTCAAAATTAAACAATGAAAAATGAACAGAAAATCTTAAGTATGCTATTTTAATTGAAAAGGTAATAAGGCATATAAATATGTGAAATATGGTAATCAAAGTTGTCAAAAATATGTCAGAATTATAAATATGAACATGTTGCACTTTCTCACATATTTCTCACTGTTGGTTTTTTTTTTTTTTTTCTCTCTCTCTCTTTATGCAGGAGTTTGTAGGTCGACTGTAATGGTCAGCCCAGATCTGCCAGACGCGGATGGTGGTAAATTGTCGGATGATGAAAACCCGAAGAAAAAGCACCGGCGGAACCGAACCACGTTCACCACCTTCCAGCTCCACGAGCTCGAGCGCGCCTTCGAGAAGTCGCACTA
T/A
CCGGATGTCTACAGCAGAGAGGAGCTCGCGCTGAAGGTCAACCTGCCCGAAGTCCGAGTACAGGTGAGAGACACTTTATTCTGTTCAAACTAATACAGCAATAATAAATATTGTATATATGTATTTATTTGTTTAAAGATGGAGAAGTATAGGCTACTAAAATACAAATTCCACTTCTAACTTTTATGTCACTGAAAAAAATGTTTCATTGGATTTGCTGAATTATTTTAAGGTAAATTGTTGCAAACAATTTATATGGGCTAAAATTAAACAAGTTAAGTTGAAAATTACTAAATTTTTAACTCGTTTGTTTAATTCAGCCCATATAAACTGTTTGCAACTTAAACAAATAAATCCAATTAATAATTTTATTTAGTGTTGGCTATATGAAGTTTACTTGCAAAAAAACGGTTACTCTGTACAGATTTTTATAAATCCTGTTTTATTGTAGTACATTGAAGATATCATTATGAAAAAGAATTGTAAAAAATGATTGATGA
(1)
Comment Citation
This T->A mutation is expected to convert the highly conserved tyrosine codon  ... ZFIN Staff
OTHER s399 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous rx3s399/s399 rx3 Unknown
rx3s399/s399 rx3 ♀+/- ♂+/-
Complex rx3s399/s399; ba2Tg rx3

CITATIONS  (14)