CRISPR

CRISPR1-efnb1

ID

ZDB-CRISPR-161220-2

Name

CRISPR1-efnb1

Previous Names

None

Target

efnb1 (1)

Sequence

5' - GGACATTATCTGCCCCAAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nim26	efnb1

Expression

Gene expression in Wild Types + CRISPR1-efnb1

No data available

Phenotype

Phenotype resulting from CRISPR1-efnb1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-efnb1

Phenotype	Fish	Conditions	Figures
hepatocyte cell migration process quality, abnormal	efnb1^nim26/nim26	standard conditions	Fig. S2 from Cayuso et al., 2016
liver primordium malformed, abnormal	efnb1^nim26/nim26	standard conditions	Fig. S2 from Cayuso et al., 2016
common bile duct disconnected, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
liver efnb1 expression absent, abnormal	efnb1^nim26/nim26	standard conditions	Fig. S2 from Cayuso et al., 2016
common bile duct duct epithelial cell morphology, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 3 from Thestrup et al., 2019
common bile duct decreased length, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
gall bladder decreased size, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
common bile duct branched, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
hepatoblast mislocalised, abnormal	efnb1^nim26/nim26	standard conditions	Fig. S2 from Cayuso et al., 2016
common bile duct epithelial tube morphogenesis disrupted, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 3 , Fig. 7 from Thestrup et al., 2019
common bile duct morphology, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
digestive system duct morphology, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
common bile duct lumen structure, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 3 from Thestrup et al., 2019
extrapancreatic duct morphology, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
cystic duct increased size, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
extrahepatic duct absent, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
hepatoblast efnb1 expression absent, abnormal	efnb1^nim26/nim26	standard conditions	Fig. S2 from Cayuso et al., 2016
embryonic liver development process quality, abnormal	efnb1^nim26/nim26	standard conditions	Fig. S2 from Cayuso et al., 2016
extrahepatic duct increased width, abnormal	efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
common bile duct disconnected, abnormal	efnb2a^{hu3393/hu3393}; efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
extrapancreatic duct morphology, abnormal	efnb2a^{hu3393/hu3393}; efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
common bile duct lumen structure, abnormal	efnb2a^{hu3393/hu3393}; efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
hepatopancreatic ampulla increased size, abnormal	efnb2a^{hu3393/hu3393}; efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
cystic duct absent, abnormal	efnb2a^{hu3393/hu3393}; efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
common bile duct epithelial tube morphogenesis disrupted, abnormal	efnb2a^{hu3393/hu3393}; efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
common bile duct decreased length, abnormal	efnb2a^{hu3393/hu3393}; efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
extrahepatic duct absent, abnormal	efnb2a^{hu3393/hu3393}; efnb1^nim26/nim26	standard conditions	Fig. 7 from Thestrup et al., 2019
common bile duct cystic, abnormal	ephb3b^nim27/nim27; efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
common bile duct branched, abnormal	ephb3b^nim27/nim27; efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
hepatopancreatic ampulla bifurcated, abnormal	ephb3b^nim27/nim27; efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
extrapancreatic duct branched, abnormal	ephb3b^nim27/nim27; efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
common bile duct decreased length, abnormal	ephb3b^nim27/nim27; efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019
digestive system duct decreased size, abnormal	ephb3b^nim27/nim27; efnb1^nim26/nim26	standard conditions	Fig. 2 from Thestrup et al., 2019

Citations