Morpholino

MO5-lama1

ID

ZDB-MRPHLNO-060520-1

Name

MO5-lama1

Previous Names

None

Target

lama1 (1)

Sequence

5' - ATAAAGCTAAAGCTGTGCTGAAATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-lama1

No data available

Phenotype

Phenotype resulting from MO5-lama1

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	WT + MO5-lama1	Fig. 8 from Skarie et al., 2009
central nervous system hemorrhagic, abnormal	WT + MO5-lama1	Fig. 8 from Skarie et al., 2009
cornea increased thickness, abnormal	WT + MO5-lama1	Fig. 3 from Zinkevich et al., 2006
eye decreased size, abnormal	WT + MO5-lama1	Fig. 3 from Zinkevich et al., 2006
eye hemorrhagic, abnormal	WT + MO5-lama1	Fig. 8 from Skarie et al., 2009
eye lacks all parts of type lens, abnormal	WT + MO5-lama1	Fig. 3 from Zinkevich et al., 2006
eye morphology, abnormal	WT + MO5-lama1	Fig. 3 from Zinkevich et al., 2006
lens degenerate, abnormal	WT + MO5-lama1	Fig. 3 from Zinkevich et al., 2006
pupil irregularly shaped, abnormal	WT + MO5-lama1	Fig. 3 from Zinkevich et al., 2006
whole organism decreased length, abnormal	WT + MO5-lama1	Fig. 3 from Zinkevich et al., 2006
whole organism increased curvature, abnormal	WT + MO5-lama1	Fig. 3 from Zinkevich et al., 2006

Phenotype of all Fish created by or utilizing MO5-lama1

Phenotype	Fish	Conditions	Figures
eye morphology, abnormal	WT + MO5-lama1	standard conditions	Fig. 3 from Zinkevich et al., 2006
pupil irregularly shaped, abnormal	WT + MO5-lama1	standard conditions	Fig. 3 from Zinkevich et al., 2006
lens degenerate, abnormal	WT + MO5-lama1	standard conditions	Fig. 3 from Zinkevich et al., 2006
whole organism increased curvature, abnormal	WT + MO5-lama1	standard conditions	Fig. 3 from Zinkevich et al., 2006
cornea increased thickness, abnormal	WT + MO5-lama1	standard conditions	Fig. 3 from Zinkevich et al., 2006
central nervous system hemorrhagic, abnormal	WT + MO5-lama1	standard conditions	Fig. 8 from Skarie et al., 2009
eye lacks all parts of type lens, abnormal	WT + MO5-lama1	standard conditions	Fig. 3 from Zinkevich et al., 2006
eye decreased size, abnormal	WT + MO5-lama1	standard conditions	Fig. 3 from Zinkevich et al., 2006
brain hydrocephalic, abnormal	WT + MO5-lama1	standard conditions	Fig. 8 from Skarie et al., 2009
whole organism decreased length, abnormal	WT + MO5-lama1	standard conditions	Fig. 3 from Zinkevich et al., 2006
eye hemorrhagic, abnormal	WT + MO5-lama1	standard conditions	Fig. 8 from Skarie et al., 2009
eye hemorrhagic, abnormal	WT + MO1-foxc1b + MO2-foxc1a + MO5-lama1	standard conditions	Fig. 8 from Skarie et al., 2009
brain hydrocephalic, abnormal	WT + MO1-foxc1b + MO2-foxc1a + MO5-lama1	standard conditions	Fig. 8 from Skarie et al., 2009
central nervous system hemorrhagic, abnormal	WT + MO1-foxc1b + MO2-foxc1a + MO5-lama1	standard conditions	Fig. 8 from Skarie et al., 2009
endoderm increased width, abnormal	ha01Tg + MO1-fn1a + MO4-tp53 + MO5-lama1	standard conditions	Fig. S6 from Hu et al., 2018

Citations