| ZFIN ID: ZDB-SSLP-980528-1325 | 
| SSLP: | z9995 | 
|---|
PHYSICAL MAP AND BROWSER
                    
                    
                        No data available
                    
                
            
        
    
    
PHYSICAL MAPPING 
                    
                    
                        No data available
                    
                
            
        
    
    
| Chr | Location | Mapped As | Panel | Mapped By | Scoring | 
|---|---|---|---|---|---|
| 13 | 43.0 cM | z9995 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data | 
| 13 | 2378.0 cR | z9995 | Goodfellow T51 (T51) | Geisler, Robert | Data | 
| 13 | 60.7 cM | z9995 | Heat Shock (HS) | Woods, Ian G. | Data | 
| Note: Physical map location as
            displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. | |||||
| Marker | Type | Chr | Distance | Publication / Person | Comments | 
|---|---|---|---|---|---|
| z3424 | SSLP | 13 | Beattie et al., 2000 | Beattie, et al. (2000. Dev 127:2653-2662.), outcrossed stumpy (on *AB background) to WIK and SJD strains to create polymorphic mapping lines. z9995 and z3424 segregated with stumpyb393 in all of the 50 mutants tested, placing this mutation on LG13. | |
| b393 | Feature | 13 | Beattie et al., 2000 | Beattie, et al. (2000. Dev 127:2653-2662.), outcrossed stumpy (on *AB background) to WIK and SJD strains to create polymorphic mapping lines. z9995 and z3424 segregated with stumpyb393 in all of the 50 mutants tested, placing this mutation on LG13. | 
| 
 | 
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] | 
|---|---|---|---|
| AB | 254,290 | 60.0 | |
| Forward Primer | TGCAACATTATCCGGGTCTT | ||
| Reverse Primer | TTGCAGAACAACCACACACA | ||
| IND | 0,232 | 60.0 | |
| Forward Primer | TGCAACATTATCCGGGTCTT | ||
| Reverse Primer | TTGCAGAACAACCACACACA | ||
| EKW | 254,0,256 | 60.0 | |
| Forward Primer | TGCAACATTATCCGGGTCTT | ||
| Reverse Primer | TTGCAGAACAACCACACACA | ||
| TU | 256,260 | 60.0 | |
| Forward Primer | TGCAACATTATCCGGGTCTT | ||
| Reverse Primer | TTGCAGAACAACCACACACA | 
