ZFIN ID: ZDB-GENE-980526-249

ZFIN ID: ZDB-GENE-980526-249

Mapping Details

Gene Name:	wingless-type MMTV integration site family, member 11
Symbol:	wnt11

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	10	37,102,894 - 37,121,758	GRCz12tu
NCBI Map Viewer	10	37,102,894 - 37,121,758	GRCz12tu
Ensembl	10	32,104,305 - 32,123,204	GRCz11
NCBI Map Viewer	10	32,104,343 - 32,123,204	GRCz11
UCSC	10	-	GRCz11
Vega	10	32,160,445 - 32,179,344	GRCv10

Mapped Clones containing wnt11
DKEY-250D21	Chr: 10 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa2545	10	37,115,536	GRCz12tu	DIRECT		Sealy et al., 2025
	10	32,116,982	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	10	32,173,122	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	10	33,071,773	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa27632	10	37,115,603	GRCz12tu	DIRECT		Sealy et al., 2025
	10	32,117,049	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	10	32,173,189	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	10	33,071,840	Zv9	DIRECT		Busch-Nentwich et al., 2013
fh224	10		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
fh225	10		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa2545	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	10		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
sa27632	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	10		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
wnt11_unrecovered	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	10		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	10		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
10	91.3 cM	wnt11r	Mother of Pearl (MOP)	Postlethwait, John H.	Data
10	52.4 cM	wnt11r	Heat Shock (HS)	Woods, Ian G.	Data
10	46.86 cM	wnt11r	Gates et al (GAT)	Talbot, William S.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by wnt11
fk73h04 Chr: 10 Details

Primer Sets:
Strain	Bandsize	Annealing Temperature [C]
SJD	732	36.0
Forward Primer	CCGAGGCTACAACCCTTACA
Reverse Primer	CAGAGAGGTTTTGCCGTTTCT