Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 6 10,812,337 - 10,828,923 GRCz11 Ensembl 6 10,812,337 - 10,828,923 GRCz11 Vega 6 10,576,910 - 10,593,496 GRCv10 NCBI Map Viewer 6 10,812,337 - 10,828,923 GRCz11 UCSC 6 - GRCz11

Mapped Clones containing chrna1
DKEY-91G17	Chr: 6 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
6	59.8 cM	nic1	Mother of Pearl (MOP)	Postlethwait, John H.	Data
6	1183.0 cR	chrna1	Goodfellow T51 (T51)	Geisler, Robert	Data
6	28.0 cM	chrna1	Heat Shock (HS)	Woods, Ian G.	Data
6	39.57 cM	chrna1	Gates et al (GAT)	Talbot, William S.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION

Genomic Feature dtbn12 is an allele of chrna1
Chr Location Mapped As Panel Mapped By Scoring 6 31.1 cM dtbn12 Boston MGH Cross (MGH) Geisler, Robert Data Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Genomic Feature dtbn12 is an allele of chrna1
Marker Type Chr Distance Publication / Person Comments z6601 SSLP 6 0.77 cM Lefebvre et al., 2004 Lefebvre et al. (2004) reported mapping the twister locus to 0.77 cM  ... Lefebvre et al. (2004) reported mapping the twister locus to 0.77 cM centromeric to z6601.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	280		36.0
Forward Primer	TCAGACCACATGCTCAGTCAG
Reverse Primer	GGTAACCATGAAAAACGCAGA