| ZFIN ID: ZDB-GENE-980526-392 |
| Gene Name: | synaptosome associated protein 25b |
|---|---|
| Symbol: | snap25b |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing snap25b | |
|---|---|
| CH73-93A6 | Chr: 17 Details |
| CH211-271I22 | Chr: 17 Details |
| CH73-313G15 | Chr: 17 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| sa7432 | 17 | 13,518,854 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 17 | 12,316,650 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 17 | 12,162,584 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 17 | 12,180,062 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa32130 | 17 | 13,539,326 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 17 | 12,337,047 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 17 | 12,182,981 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 17 | 12,200,459 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa36346 | 17 | 13,518,749 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 17 | 12,316,545 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 17 | 12,162,479 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 17 | 12,179,957 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sbu83 | 17 | 12,384,993 - 12,385,045 | GRCz11 | DIRECT | Moravec et al., 2016 |
| zf4280 | 17 | 13,509,199 - 13,509,204 | GRCz12tu | DIRECT | Zhang et al., 2024 |
| sbu83 | 17 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| tpl27Gt | 17 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 17 | 54.8 cM | snap25b | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by snap25b | |||
|---|---|---|---|
| fj33h05 Chr: 17 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 590 | RsaI | 36.0 |
| Forward Primer | GACATGGCTGACTCCAACAAAA | ||
| Reverse Primer | TGGCAGGCTAAGATAAG |
| Genomic Feature sbu83 is an allele of snap25b |