Genomic Feature

m425

ID
ZDB-ALT-980203-819
Name
m425
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 43721319 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Tyr>Stop at position 86 (1)
Sequences
Flanking Sequence
GTGTTAATCCAGAATGTTTCGCCTATAGAACTGCAGAAATAATGGTGCTGCCTTGCTTACTGCAGTAAACAAAGTAGTGTGACATCAAATATAGCAGGATTTTATCGATTTCATAAACTACACAGCATCCTTAAACTTCAAACATTAGCATACAACTATAATTATACAACTGTATAATCAAAAATGATGCAAAATTTAATTCCTTCTAACAGCATTTAGGACTTAACTCTAAATTGATTTAGCAACTTTTAATACTTTAAGACCCCGCGGACACCCTGTGGTAGAGCGGGCAGTTAAAGGGTTAAGAACCTCTTTTTCAACAAAACATGACTTGAAAAAAAAAAGGTGGTTTTCTCGATATTTTACATTTTTTGAGCACATAAAAAGGTTTTATCAACAGGTTACATCAACTAAAAGCTTTCTGTAAACATTGTAAGTGAAAATCTCACCTGAATTCTCGATTCTGGCAAGCCGGTGAGTGCCTCAAGCTTCTCTCGTAA
A/T TAAATATCAGGGTATTTGGTGTCCAGGTAAACTTTCTCCAGCACGTCGATCTGCTGCTGCGTGAAGTTTGTGCGTTTTCTGCGGTGTGTAAACAAACTGACGTTGTCTGCCCTGGAGGCACCATCCAGGAACTTCATCCTGTCCTGAAGCACATAATCTGAAGAGAAACAATGAGTAAAGCTTTAAATTAGACAACTAAATCCATACTGTAGGTTTTCTCAAATACAGGTAAAGGTATAGTTCATCCCAAAATGAAAATGCACTTACTAGGCAAAAATGCAAAATTGTAAATTATTTTCCACATTGAACCACAACGATACACATTTCGATAAACGTTTTGAAATAAAAGTACCCAAACAATGACTGAAGCCATAAAAATTAGAGGGTCCATTAAATAGCATAACATATTTTTGGCTGATAAATTTTCAGTGGCAGAAAATTCAGTACATCATTAATATCAACACACTTTTAGATCCCCATTGTTGCACAGTTCTGCTGTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations