Genomic Feature

m248

ID
ZDB-ALT-980203-568
Name
m248
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 21: 1652022 (GRCz11) (1) Details
Nucleotide change
G/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T in Donor Splice Site (1)
Transcript Consequence
None
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CCGTAGTCTATAAGTGTGTATGGGTGTTCCCCAGTACTGGGTTGCAGCTGGAAGGGCATCCACTGCAAATAACATATGCTGGAATAGTTGGCAGTTCATTCGGCTGTGGCGACCTCTGAAATAGAGACTAATCGGAAGGAAGATGAACGAATAGAAGATTTCTAAAAGTCTTCAGCTTCAACACAAAAGAAAAGCTTTAAAGTGTGGAATATTTCCTGCTGTCTGGACTTCTCATGTGCAGCATTCTCTCAGGGTTTACATTAATGCTTTTAGCTGACGGTTTTAAAAACGGGGCTTTTCTTTTCTCCACTAAGTCTGACTCTTCTGCATGACTGAACATTCACTGAGATGACTAAAGAAATACTGTGTTTTCACTACAGAAAACCCAAAACAGGCATTCTGATGCTGAATATGGGCGGTCCAGAGAAGCTGGAGGATGTTCATGATTTCCTGCTGCGCCTCTTCATGGATACAGACCTCATGCAGCTGCCCGTGCAGAA
G/T TAAGAAAGACTATTCAACATTTATAGGTCTAATATATACACTTCCTGACAAGTTTATTTTTTATTTTTATTATTTTTATTATTTTTTTTATTAACAAGAACCAGCATGTACAGTTTTCTTATACAATACAATACAATCACTTTACATTTCTTAACAAGAATGAAATGAGTGAAAAAACATAAAGGAGAAGAGAAAGAAAAAAAAACAGAGGAGAGGGTACATAATTATCAAACTACATATAAATATGTTTCGCACATTTTCCAATTTTAGTTATTTACAAGAGTTAGTAATGCACTTTTTTTTCTTTTCTTTTTTTTTTTTACAGGAAATTCATTTATACAAACATTTTATGTAAAAATGTTAAAGGGTCACGACCAAAACAACACCAGAACACATGTGTTGAGCTGTTGACAGTCATATATGTGTCACACACTGCTAAAAACACTATTAGGACACCTATATTTCACTTAAAAGTGTAAATTGGTTGTTTTTACGTTATT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations