Genomic Feature

m768

ID
ZDB-ALT-980203-531
Name
m768
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (2)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 12: 13728731 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
Single-nucleotide substitution leading to an Arg->His at the beginning of the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Arg>His at position 94 (1)
Sequences
Flanking Sequence
CGCCCAGGGTAGATTTAGATGCGCAAAATGCATTAAACTCACCCCACATATAAATAGTCCTGTACATAATTTAAAACATTTTTGGATGTAACTGCGGAAAGCCTCAACATTTCAATTAATGATATTGCAATTGCGACCTTACACTTTAAATTGAGAGTGAATGCGTGGGTTTGACAGTTTCCTAATGAAGATGTTTCAGCTAAAACCCTTAAACTTTTAAAACCCGCAAACAAATACAGGGGTTTGTTGGGGTAGAGCCACGCATCATATTTCAGTACAAACTTTCACATTTAATTCACTGTGATGCTTGCTGTTTCTTTGCAATTACATATTAAATTTACTGAGGTTTCTACATTATTACTAATTGCGCATTTTGACTAAAAAAAGTTTAAGTTTTTCAATTACTTAACCCTACCTCTGATAAAGTAAGCTTCTTCTCTGGCGAGTTCTGGATGACCATTGCGATCATTGCCAGGTAAGAGTACGGTGGTTTGGGATAA
C/T GCTGATAGTTTTTCTTCTTTCCTCCACTGGAGTTTCCATCCTGCAGTTCCCATGGGCCTTGATTCGTCGCTTTGGCTCTATAACAAGAGTCCTGCGCCATCCCTGTGGACTTATCCAGCCGGCCACCGAGCTCCAGCAAAGGGTTTGAGGAGCGATGACAGCTGCGCTTGGAAGAGGAATAGCCGATTCTGCAGTCAAGGTGATGGTCGCGTTGTGCTCCTTCTCCTACGGTGATCACGGGTGGTGCCAACAAGCCTGGACCCCCCCAGTGCTTTGTCATGCTGATGTAGTGGGGGGAGGTGGAAGGTATGGTCGCTCCTCAACCCCTCAGACTGCTGGCTCCAGGTCAACTCTATTTGAGCAGCAAACAATTCACAGTTTCATGTCAATCCCGCTGCGTAATGGGAGTGAGAATGAGGCGCGATGCGCGATCACCGCGGGGGAGGACACTATACATCAGCGATCAGATTTACTGTGAAAGGCAGTTTAAGTGGCCTTTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations