Genomic Feature

m168

ID
ZDB-ALT-980203-496
Name
m168
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
Fekany et al (1999): guanine-to-adenine transition (TGG->TGA) introduces a premature stop codon resulting in truncation of the dharma open reading frame (ORF) at codon 70, 45 amino acids upstream of the homeodomain.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 15: 29012215 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
Fekany et al (1999): guanine-to-adenine transition (TGG->TGA) introduces a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TGTCGGTAAAAACCGTTCGGATTCGACCGCGCGGTCGCTGAGCGATTGTGTGGTAGTGATTCTCAGCTGTTTCACAACCTAGATGCAATTTTACAATGAGTTATAAAAAAACACATTTTATATGGCATTTAAAAATAAAAATTATATGGCATTGTATAAATAGGCCGGTTTTATAACTACAGTATAAAAATCCTGGTTGCCTTATATTTTTAAGCTGAATCAAATTAACCTTATAAATCCATTGAACTTACTAGTTACTACCTGACTTAAAACTGCTTGCATAACTCAGAACATGATTACCTAAGTTTAATAATTACAATATAGGCCTATATTTTACAGTGTAGCATATTTATAAGTAGGCTATAAAATAAATTTCATTGTTTTATATATTTTTTAATAAATTGAAAATGCATACCGGCTACGGCATAAGGCCACGGTTGCCCTGCATAGTAAGTCGACTGGTAGTAGGAGACTGGAACGCAGCAGCAGTACATCCCTGG
C/T CATGATGGACAAGGAAAGTTCACCATCAGTGCTGCACGATCACAGTGACCTCTACATCCTTCTTGGTAGAGCTGGTCCAGCTTTCTCAAGTGCCCCTGGAAATCTTGAGAAGATGCTGGATGATCCACTCCAGGGGATTCTGCTGTTTGCCTGCTGGTGTCTCCTAAGATGTAATCAATGGAGAAGTTTGAAAACTTCTGAGTTGCCATGTTCAAGTGTAGGGGTGCCCAAAAGCTGCGTGAGTATGTAGTACTCTCTCCTCTTGCTCTGTCTCTAAATAATGACATACAACTGGAAAGGTGTATTTGTACTCTCTGTGTCTTTTTAACTGAGGTATTAATGTATTTAATATTGGCCCATTAACACCTCTTTGTAGAAGTGGAAGTCAAAGGAAATTCAGTTTTGAAGATCCACTTTGAAGACCCTGAAACCCTTTCAACATGACACTTCAAATTAACCTGATGATGATTCTGTTTATTGATCACACTTCAACACATTAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
m168.pdf
Citations