Genomic Feature

tm236a

ID
ZDB-ALT-980203-482
Name
tm236a
Synonyms
  • AM036A (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
The substitution is in the first base of the third intron. Two different mutant cDNAs were isolated. The more abundant cDNA, resulting from the use of a downstream cryptic splice site, contains a 31 bp insertion that is predicted to produce a translational frameshift. A less abundant cDNA, using a cryptic splice site 30bp upstream of the mutant site, is predicted to produce a 10 amino acid deletion in the 2nd zinc finger of the protein.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 23: 7384728 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
The substitution is in the first base of the third intron. Two different mutant  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A in Intron 3 (1)
Transcript Consequence
Cryptic Splice Site (1)
Protein Consequence
None
Sequences
Flanking Sequence
GATGTGTTAAATGACTGGAATACACAGTTCTGGTCACAGAGTTATCATCTTTTTCTTTTAATTTTTTTAATGACTCTTACTTTAATTTTAAACAAAACTCAATAACATTACATTCATCTCTGCATTATATTCTATAGGAACATAATTTCAAAAAACATAAATCAATTGCTTCATTGACTTTGTTGTCATGTTACAATTCTTTAACACATATTAACTTTTAAAATAAATATATATTTTTAATCAAGGTTTGACATGTCCTTATATTCCTCTATTAAATAACTTTATTTCATTTACTGTCTCAAAATTCCTTTCAGCTTTGTAAAATTATCAAATTAATCCCCTCTCAAACTTCTGTCTGTTCTTCTCTGCAGCAAAGCACATCACGACGAGCAGGTCTGTGTTGCACTAACTGTCATACTAGTACGACAACACTGTGGAGGAGAAACGCAGAGGGAGAGCCAGTCTGCAATGCATGTGGACTTTACATGAAGCTTCATGGG
G/A TAAGAACAGGATTTAGTCTGCATTATTGTGGTACCAAAGAATTTTGAGAGGCTGCATGGTGGTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCTTTAGACCATGTGATGCAAAGGTCATAGGTATGTTTTATCGGAAGAGAATGAGAAGAGAGAGAGGAAGGGGAGTTGCTTAAATAAGCTTTGTTCTCTAAACTAGCTCTTCTCACAGCTGACAAAATGACTCAGAAACTCACAAGAAAATAAATTAAATCTGCACTAGCTGTTATAAAGTTGTAATTATTGTGGTTTTTGAAAGAAGTCTTTTAAGTTTACGCTTAAGTTAACGCTGCAAAGCGGAATTTTCTGCATCATCATGCTTGTCCTCAGTGTCACATGATCTTTAAGAAATCCTTATATGCTGATTTGCTTCTCAAAAACAATTCATTTTTGTAATGAATACTGAAAAAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations