Genomic Feature

ti262c

ID
ZDB-ALT-980203-1165
Name
ti262c
Synonyms
  • AI62C (1)
  • flotte lotte (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 17: 12227705 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Arg>Stop (1)
Sequences
Flanking Sequence
TTCTGTTGGGTCCCGAGTATCAAGATGCTCTGACATCTCAGGCACAGATTCAGAGCTTGGTTCCTGAACAGGAACAACCAACTCTGGTTTAATAACCACATCTATCTTGAGAACCTGAGCCTCTGAAATTCCTTTTAGCTGCTCCTCGCTTACGTTCTCCACAACATCATTGGTAATATTAACACACTCCTCCTCATTTTGGGCTTCCTGTATGCCTAAAGATCTCTCTGCATTGGACAAGTCTCCCCTTGAATTGTCCTTTTCTTTCTCAGGCAGCATAAGAGAAGGCAAGTCCACAGTTGTGTTCCTTTCTACAGGAGCTGTATGTTCCTCAAAAGTGTTTGGAAGTCTTACTGTCACCTCTCGATCCACACTATTGTTTGCTTGCTGCTCTTTCAGAGTAATCAAAAGATCCTCGGGAGCAGGAGCATCATGAAACTCAAGGGTGGTATCGGATTGGTTGGATACAAGACTTGCTTCTTGCCCCAAACTAGGCCGTC
G/A CACGAGAGTGGGAAGCACTTTTGTGGACTCTGCTAAGGGGATTTCTTTAATAGAGGATCCAGTCTCAGATTCTACGTCAGGATTCTCCTGCTCTCCCAGAGAGGGCATGCATGTCATTTTCATATCTACATCTTCCTCTTCAGCATCTGAATGTTCACTCCAGACCCCAATGCTTGCTTTAGCAGGAGGAGAAGATCGCTTAGGAGTATTGTGCTCCCTGTTAACTGAAATCTGTGGAGAACCAAAAGCATTAATCACTCTTGCTAAAATTGTTCCAATGTTTTAATAAGTAGGGCTCATGGAGTATGACTTCTATAATATGCAAGATACAAATTGACAAATGTAAAGGTATATAACTATTTACATTATTATATTTACAGTGATAATAAATGCAATTGATCTGATTTTAGATAGACATTTGATTGTAGAAAAGGCACATTACCCCATTGTTCCAGTGAACAGAGCCTTTGGGAGCTTCTGGAGAATCAGCATCCTCTATG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations