Genomic Feature

to273b

ID
ZDB-ALT-980203-1138
Name
to273b
Synonyms
  • AO73B (1)
Affected Genomic Region
Construct
None
Type
Allele with one MNV (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
MNV
Variant Location
Chr 7: 26847225 - 26847226 (GRCz11) (1) Details
Nucleotide change
TG/AT
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TTCCTCTACTGAAGGTATCTACATGCCAATCTTGAGTCACAGTCATAGCACCACCTGCTGACAGGAGAAAGTTTGGCATAAATGTGTGATTTTCTCATATATATCGGCCAAAATTAATATTGTTCGCTGTTCTCTGTCATCCTGAGGCCACCGGGGGCGGTGAGCCCGGGTGCGAGGTCCCTATCATCGCTGCTTGCAGCTTTAATTAATTTATTAAAATCATGTATGTCCTTGAGAACATTTAATGATATTCTCTGACATATGTTCATATACAGTACATCAGTGCTGTTAGTGTATTCTGAGGGGCTATTTTGTGTCCTTTCGCAGTGGTTTTGTCTGGACAGGCTCATCATGTGTGCATCAGGGAAGTACGGTTCACGGGGCCCTGCTCTCATACCCCGCATGAAGACTAAACACCGGATCTACTACATCACCCTCTTCTCTGTGGTCTTGCTGGGATTGATCGCAACAGGGATGTTCCAGTTCTGGCCTCACTCCAT
TG/AT AGTCTTCAGCCGAATGGAGTCTGGACCGCCGCAGTGTGCACGATGCTCCTTTGGTCAGGATTCCTGTGAACAGTCCTATTCCTGGGAGGGGTGACCTGAGCTGCCGGATGCACACCTGCTTTGATGTTTATCGCTGTGGATATAATCCTAAGAACAAAATCAAGGTAATGCACAAACAGAGAATGTCCTATCAAATTTTTTAAACTTGTTTGCTGGATGTCATCCCTGTGCATCTTTTAATTAAGAAAACTTGCAGTAGCATTTGCAAATTTGAAACATCATGTTAGTGAACATTCGGAATCAGCTCACGATGCACATTAAATAAACAAGCCACCTGTGAGAGACACAATCTTTCCTCTCCCTATGCATCAGACACTATAATAAACAATAAACACTCCATGTTTCTGAGCAATCCTGGGTGTGCTTCACACAGGTGAGTGGGCTTGGCAATCACTCATAAGGAAACATACTCTTTCCTCTATCAGGCTGTATTTACACTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations