Genomic Feature

b1

ID
ZDB-ALT-970801-19
Name
b1
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
spontaneous 
Lab of Origin
Streisinger Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 18: 5217716 (GRCz11) (1) Details
Nucleotide change
C/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Tyr>Stop at position 208 (1)
Sequences
Flanking Sequence
ATCCATCACAGCACCATTAAAAGATCTAAAAACTGAATGTAAAAATAATTCATTAAATCTCTAATGTGTTTGTGTCGTCTGTTCATTTATTATGGAGGAAAGCTGGAGCTGCAGCGGTGTCCCTGCTTCAGAAACACCTGCACTGTTACTGTTGATCATTTGTTTCAGACTGAGGATTTTGAGCATGTGTGTGTGTTGTTCTTGCTCAGGTGTGTTTGTGACGAAGGGCGACATCGGCGTCAGCACCATCATGGGTTCTGCTGTCTATAACCTGCTGTGCATCTGTGCAGCGTGCGGCCTGCTGTCCTCTGCAGTGCGTGACTACACACACACACACACACATGTTTGTTTATGCTGATCTGACATGATGTTTATGCTGATCTGTGTGTGTGTGTGTGTTAGGTTGGTCGTCTGAGCTGCTGGCCGTTGTTCAGAGATTGTGTTGCGTACTCCATCAGTGTCGCCGCCGTCATCGCCATCATCTCAGATAACAGAGTTTA
C/A TGGTGAGCCTCCCATCACTCCTCACTTTATTCTCTGAATACTTTGTATCTCACAGTAATGACTGTCAACATTTCTGATTTACTTTTCACTATTTAGACCTTTCATTTTTGGATTTCAAATTAGTTTTTCAGTTCTGACATTGTTTTTTATTTTTACAATTTTTGAAATTTTTATTTACTTTTCACAGTTTTGACGTTTTTTTTCCCACAAAATTTACGTTTTTTTATTTCTAAATTCTGCCGTTTTTAAAACATTTTATTTACTTTTTACAAAATTTACGTTTTTTCGACGTTTTTTTTTTTTTTTTATTCACTTTTCACAAAATTCATGTTTTTTAAAAAAATTCTACATTTTGACGTTTTTGAATTTTTTTCATTTACTTTTTTTTTCAATTTACATTTTTAAGAATTTTCACAATTTTTGTTTTTTTATTGTTTTATATATTTTTTACAAAATGTATGTTTTTTTTCAATTATCTAAATTTTTTACTTATTTAATTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
b1.pdf
Citations