Genomic Feature
ihb908
- ID
- ZDB-ALT-250414-5
- Name
- ihb908
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one delins (1)
- Protocol
- embryos treated with
- Lab of Origin
- Yonghua Sun Lab
- Current Source
- Other Pages
-
Notes
| Comment | Citation |
|---|---|
| 41bp has been mutated into GCTCGCGCAGAGAGACTTCTGACCTGTGACCTGTGG(36bp)in exon2 ... | Zebrafish Nomenclature Committee |
Variants
- Variant Type
- Delins
- Variant Location
- Chr: 23 Details
- Nucleotide change
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- 36 bp inserted / 41 bp deleted in Exon 2 (1)
- Transcript Consequence
- None
- Protein Consequence
- None
- Flanking Sequence
- None
- Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None