Genomic Feature

t14ae

ID
ZDB-ALT-200805-2
Name
t14ae
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 19: 21920642 - 21920645 (GRCz11) (1) Details
Nucleotide change
CTCG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp deleted in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
AAACCCCGTTGCTGATGCTGCTGCTGCTGGACTCCAGTAAACTTTACAGGATTTTCAGCCTCCTCTGAAAAATCAATAACCCAAGGAAATTAACTGCAGAAGACTTCCTTTTCACGACGAAGCATCAAAATAAGCTCACGCTGAAGATGGGCACCCAAAACAACAGTGATTTGGACAGACCTAGAAGCAACATAGACTTAGAAGCACCTGAAAAAAACCTATTTGGCATCGGCACAGACAACTTAGTCACGCTTCTGATTTTCGGACTCATATTTACTCTTGGCGTCCTTGGAAACTCTCTGGTGATCACCGTTCTGGCTCAACGCAAACCCGGACAGCAACGAAGCACCACCAACATCTTCATCCTCAACCTCAGCGTGGCAGATCTGTCCTACCTGCTCTTCTGCATCCCTTTTCAGTCCACAGTCTACATGTTGCCCACATGGATCTTGGGCGCCTTTATTTGCAAGTTCATCCATTACTTTTTCACCGTGTCCATG
CTCG/- TAAGCATCTTCACCTTATCAGCCATGTCGGTGGACAGGTACATCGCCATAGTGCATTGCAGAAAGTCTTCGTCCATTCGAGTTGCGAGGCATGCGCTGATCGGGGTGCTGGTCATATGGGTGCTCTCTTTCGCCATGGCCACTCCGGTCGCCTACTATCAGGGCATCGTGGAAAGTGAGGACAACAGCACGTTTTGCTGGGAAGTGTGGCCAGATCACGACAGGAGAAAAATCTATGTGGTCTGCACTTTTGTTTTTGGATATGTGCTGCCGCTGATTCTGATTTCTTTCTGTTATGCCAAGGTTGGTGGATTGCCTTTAATTGTAGCTCGATAATGTAAAGTTTTGATCCTTATTCATGCAAAATATGGATAGTTTATAGTCTATTAAACAAGTCACTGGAAAAAAAAAGATGCTTAAGTAGGCTAATTGAGAAGCAGGAATCCTTTTTTGCCGAGCTCCTAAAAATAATCTTTGTACTTGTTTACATATTTACATTAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations