Community Action Needed: Please respond to the NIH RFI
Genomic Feature

kum1

ID
ZDB-ALT-200205-1
Name
kum1
Synonyms
  • EP3-/- (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Sugimoto Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 6: 37308902 - 37308908 (GRCz11) (1) Details
Nucleotide change
CTGCTTG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TGTTCTCTCGGAGGAACTTCGTTGGTTAAAATGTAAATGCTCTTACTATTCGACGTGCACCGAGGAGAAAATACAAACAAACTGAGGAACACGTACATTTACGCACAAACGACAACATTGTTAAGGTAAAAATGTTCTTTGTGGGTCCTACAATATTTTTATGTTGTTTTCTGAGTGTGTTTTCCATTTCCATAAGGGTCCCGCCTCTGTGTTTATAGCGCGCGCGCTCGGCCAAAAGTGAGACAGAAGTGAAGCAGACTTCAGTGAGGACTCTACCTGTTTCCAACGGCCATGAACACGCTCCCTGAAAAAGGATGGCATCAAAATGTAAGTCTTCAACTGTCTTGCTACAAAACCTGACTGCTGGAATCATGCCGGACTCGAACATTTCCAAATCTTCACAGGACAGCCCGGGCAGGAGCGCCGGCTGCGGGTCGGTGTCCGTGTTTTTCCCCATCACTATGATGGTCACTGGAATGGTGGGAAACTCTCTGGCGATG
CTGCTTG/- TTTATAGTGCATACAGAAAAAAAGAGAACAAAAGGAAGAGATCATTTCTGCTTTGCATCGGTTCATTGGCGTTAACTGACCTTTTCGGACAGCTGCTTACAAGTCCGATAGTCATCTCGGTGTACAGGGCAGATATGAAATGGGACCGCGTGGACCCGTCCAAAACTCTCTGCGCCTTCTTTGGGGTTTGCATGACCACTTTTGGCTTGTGTCCTCTCTTTTTAGCCAGCGCAATGGCTATTGAGAGGGCCTTGGCCATTATTGCGCCTCACTGGTACTCGCATTACATGAAAACCAGTGTGACCAAGCAGGTCCTGGTCATCATTTGGTGTCTGGTTTTGCTCTTTGCCTTGTTGCCCATTGCTGGTGTTGGGGAGTACACGTTGCAGTGGCCAGGCACTTGGTGCTTCATAAATACTGGTGACAAGGACGTAACGGGAAATACGTTTTTTGCCACAACCTTTGCAGCACTGGGGATATTTTCACTGCTGGTCACCTTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations