Genomic Feature

ip7

ID
ZDB-ALT-190620-8
Name
ip7
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Herbomel Lab
Current Source
Other Pages
Note
tcaga(ATG)GACCTTCACCGTGTGG repalced with ATT
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 3: 22345577 - 22345600 (GRCz11) (1) Details
Nucleotide change
TCAGAATGGACCTTCACCGTGTGG/ATT
Variant Notes
tcaga(ATG)GACCTTCACCGTGTGG repalced with ATT
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AGCATGCATCGGCATGCCACGACGTTAGTCATGCACAGTGTTTTCTGCTCAATATAAGACTACTCATCTGCCATCATTTATTCATATTCAGTGGAATGTATTTATTTTATTGGGATTTGTTTGCACCCTGGGCTCTTAGATACCACACAGATTAATTAAAACCCGAAAGTTGTTACTCTAGCAAAACATATTCCGTTAGCTTCCGTTAGAGATTCTCTTGAATGAACGAACTCGAAAACTCCGCGCAAGACCTTCATGAGCTCGTGAAAAATCCCCTCTTTCTCTTCAAGATGAAAGAATTAATGCGAAATCACGCCTTTTCGATTTGTTCACAAAATACTGTATATAAACTTCAGATACATTGAATCCATCACATAACGACAATCGAGTTTTGGAGGATACTCAACATTTCAAAGAGGTGAGTCAGATTATTGACCCATAATTAACCTGGTAATGTATAGTTTGCATCATACTAATTTCTGATTCCGTATAGGCATCTG
TCAGAATGGACCTTCACCGTGTGG/ATT CCTGGCTGTGCACCTTTTTCTGCTTTGTGCAGGTTTGGTCATTGCCAACAAACTGCAATCTTCAGAAAAACTTAATGAAGAGGACCTATACACTTCTGGAGACTGCGGTAAGATTTATTGCAGATAATCGTCAGTTTTATTATTGTATGTAACGAATAATTAATTGCATATTCAACATGTGTTAGGTCGTCTAACGAATATAATCTTGTTTTAGGGAGGGCTTTTCCCTATGCAATGCCTGGACGACCGCGTTTCTATACCATTCCCGCAAAATGTGTTCGAGTATAACGAGGATCAGGTAAAATCTTTAACACAGCTGTTAATCTATGGGTGCTTGGCATATTTGACACTTCCCAAAAATCTTTCATTTAAATTAATATTTTCTATAGGATGTTTTACAAAATTATATTTGTGCATTAGTTTAGTCAGTACTGAAGCTAAATCTGGAGCTAATCTAATAAAATAACTTTTATAATAATGTAAAAAACAAATAGCCCAAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations