Genomic Feature

uf2

ID
ZDB-ALT-190108-1
Name
uf2
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Kramer-Zucker Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 24: 10414222 - 10414241 (GRCz11) (1) Details
Nucleotide change
CCAGCCGGAGACAGTCGCTC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
20 bp deleted in Exon 2 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GACAATTGGACGTTTCACGCGTGTTTTTGACTTGAAGTGTTGTTTGACAGTAAGTTTGGTTCGGATGTGCGCTCGAATAAAGCACCACAAGCAGAGATGCTCGAGGATGTTTTGGTAGAAGTAACCGCCGCTTTGGGCTTCACTCGCTGTTTTTACACACGCTGTCAGTTGCTTGTGTTATTTACACGCTTGAATATCTTTATATGTGCAGTTTTTTTGGTGAAGCTTTTGTGTTGTGTGTTTAGTTAGACGTTGCCTCTGCACCGTAGTGATTCATATTTGTTTTTTTTTATCTCCTTCCTCAAGTGTCAAAATGCTGGTGAGTGCGAGTTTGGCGTGTAAAAACTACGATTACGACTACGACTCCATCCAGCCCTACTTCTACTTCGACAACGACGATGAGGATTTTTATCACCATCAGCAAGGACAGACTCAACCTTCAGCCCCCAGCGAGGACATTTGGAAGAAATTCGAACTGCTGCCCACACCGCCCCTCTCGC
CCAGCCGGAGACAGTCGCTC/- TCCACCGCGGAACAGCTGGAGATGGTCAGCGAGTTCCTGGGAGACGACGTGGTCAGCCAGAGCTTCATCTGCGATGATGCGGACTACTCCCAGTCCTTCATCAAGTCCATCATCATCCAGGACTGCATGTGGAGCGGCTTTTCTGCCGCTGCCAAGTTGGAGAAAGTGGTTTCAGAGAGACTGGCGTCTTTGCACGCGGAAAGGAAGGAACTGATGTCTGACAGCAACTCAAATCGACTAAACGCGAGCTATTTGCAGGATCTGAGCACCTCTGCATCAGAATGCATCGATCCCTCTGTGGTCTTCCCATATCCTCTGACAGAGTGTGGGAAAGCCGGCAAGGTTGCATCACCACAGCCCATGCTGGTCCTGGACACTCCACCTAACAGCTCCAGCAGCAGTGGCAGCGATTCAGGTATGTTATGTCATTTAGATCTCCCCACATCCTGATGTAATGCATGCTCGCGTTTGTAAGTGACCTCTACTTGTCACCGCTGAGG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations