Genomic Feature

udm103

ID
ZDB-ALT-190107-3
Name
udm103
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Pierre Drapeau Lab
Current Source
Other Pages
Note
Homozygotes exhibit premature mortality beginning at 6 weeks post-fertilization, almost none survive past 10 weeks.
mutation sequence details GACA  CGTTC WT GACCTTCGTTC mutant
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 21: 42079040 (GRCz11) (1) Details
Nucleotide change
T/GGA
Variant Notes
mutation sequence details
GACA  CGTTC  ...
Homozygotes exhibit premature mortality beginning at 6 weeks  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
3 bp inserted / 1 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CTTTTAATTTGTCAGTAACCATTGGACCATTTTGATGGTCCATTTGACTATTAGTAGACTGTCTGCTTAATATCTGTTATTACTGCTGCTAAACAGACATTTAACTGACTATAAGAAACTTTGCGACCACATTTCAACTTACACTAACCCTATCTCTAATCCCAACCCAACAGTCTACTTAGAATTTAATGAGAATTAGTTGGCTTGTAAATGCAATGTAACTTAAATTCAACAAACGGATCATAAAAATACCTGAATATCAAAAAAATCATAAATGCTATTCAGGTGTTCTTGGCAAGTGAAATGACTTCACATCGAACACAGACACCAACGAAATGTGATCAAATCCAATTCTGTCCCAGTAGACAAAGTAAATGAAACACAAATAGAGGAGATTCACCTCATGGTGTAAAGCAGAGTCCCTTCCTCTGTGATCCGCAGAAGTTTGTTTGGCATGGTCATGTTATGGGCAACGGATTTCTTGCCGTTGTGGAAGAACG
T/GGA GTCGGGAGTCCAGATTTTGCTAGCCATGAGGTTGTTGAGACGGAGCACGGCCATTGGGCCTTTAAATTTCAGCCTTTCATCCTTCCAGCTCTGCCTGAAGAACACATCTATGGTGTACTCCTGCAAAACCACAGTAAACATGTTCTCATGATGCATCATCGCTCGTGTTTCCTGCTGAGCCTTGTCACAGACAATTCTGGAATCTGATGTATGCCTCCAAAGTGGTTAAATAGTGTTTTCCTGTATAACTAACAGCATTAACTGTTCTCAGCCAGTGCAAAGGAATATTAACATTTTGAAAAAAACAGCTTAAACCAGTCTAGGCTGTTTGGCTGCTTTTAGCTGGTTGACCAGCCTGGTTTTAGAGGGGTTTTGGCCACTTCCAGGCTGGTTTCCAGCCATTTCCAGGCTTGTCTTAGCTGGTCAGCCTGGAAATTGACCAGCTAAAACCAGCTTGACCAGCTACCAGGCTGGCTAGGCTGATCAAGCTGGTTTTAGCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations