header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-180816-1
Genomic Feature: hki2
Synonyms:
Affected Genomic Regions: hrh3 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-hrh3
Lab Of Origin: Panula Lab
Location: Chr 7: 41749382 - 41749386 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 5 bp deleted in Exon 2 (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
GAAAGCGGCAAAGCACAATGCAGTCCTCTTTATTGTCCGTGGCGCACTCTCCCGGGATACCTACAGCTGTTTCATTGATGTGGAAATCAGGAAACCATCAGTCGTCCAACTGGTCTGGGATGGAGAGAGAAAACGCGACGAGTCTCGCAGACTTGGACACCTTTGAGAACCGGCGCGCGCAGTACGGCCAGTTTTCTCCATCCACCTCCATATTCCTGACGGTGCTCATGACACTGCTGGTGTTCGCCACCGTCCTTGGGAACGCGCTAGTCATTTTAGCCTTTGTGGTGGAGAAAAGTTTACGCACACAAGGCAACTTTTTCTTTTTGAATTTGGCTATAGCAGACTTTCTTGTCGGTGAGTGATATTGATGAGGTTTCTATGTGTGCATAGGGATTTCGTGAGCCTCAAGTGTTTATGTGTGTTTTTAATGGATTTTCAGGCGGGTTTTGCATCCCCGTGTATATTCCGTACGTCCTGACGGGTGAGTGGAGACTGGG
CAGAG/-
GGCTGTGCAAACTGTGGCTGGTGGTGGATTATATGTTGTGCACCGCGTCAGTCTTCAACATCGTGCTCATCAGTTTCGACAGGTTTCAGTCCGTCACGAAAGCGGTGAGTCCTGCGCAAACCCCCACACCTACTGTCCTTCGGAGATATTTATTAGACTCTTACAAACGCGTGTATTCGAAGTGATTTCATATATGAAAAACCATTTTGGTTCCCCCACCAAAACAAATTAACTTATGAAGAATTAATTTTCTCGGTGTGAAGAACATTATTAATATTCAATCAATTTTTACTGCACAAAAGACCTTTTCGGGGATGAAAAAGTTTAAAGGTCTTTCTGGAAACCATCAATGCCAATAAAGCTCTCCATATATAGAATGGTTACCCAATAATTAACATTTATTTACAGTTTACGAAGTGGGTCTAAATCATTTTCTTTTGAACACAAATAAAGTATTTTGAAGGATGTTGGAAACAGGTAGCAGTTGACGACCATAGATA
NOTES
Comment Citation
A five-nucleotide deletion results in a frameshift after amino acid 133, and a  ... Puttonen et al., 2017
OTHER hki2 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous hrh3hki2/hki2 hrh3 ♀+/- ♂+/-
Heterozygous hrh3hki2/+ hrh3 ♀+/- ♂+/-

CITATIONS  (1)