Genomic Feature

t615B

ID
ZDB-ALT-180813-4
Name
t615B
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
N├╝sslein-Volhard Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 17: 30664419 - 30664420 (GRCz11) (1) Details
Nucleotide change
GG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp deleted from position 1057 to 1058 in RefSeq:XM_002665204 in Exon 2 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GCCCTGGAAATAAACACACACACACACAAACAGATTTTAAAATAAATTCACAAACATAATGAATAATGTGCATATTAACACTTACCTACCTGTTAAATGTTTTAAAAACTTATCCTTCTGTCGAAGATCTCTCGGAAAGACCTCTGTTAAAACAGGAGAAATTCCTCAGGTTGCAATTTTTTTGGAAATGTAATGCCATATTGGTAGTCCTACAAGTATGGGCCAGTATTCACAATCTAAACACTTCTGTCAGGCATTGCATGTGATGATGCTTACCGAGAATGCGTTCATGTTGATATGACTTTGTGACTTTATTAACGTCTTTTGTTTCCAGCGAATGCTCGATGATCTGAGGAGGATGCTGTGTGTTTCCCTCACTGTGATGCTCCTGTGTCTGTCTCACTCTGTCCATTAAGAGCTCCAGCAGACTGGTTTCGTCTCTGTCTCTCGGTTTGCAGTAGCCGGTGGTGAGGATCAGCAGTAGGAGCCCTATGAAGACA
GG/- TGGGCGCACTGCACTCATGCTGAAAGGTGGGCAAAGAGAGCCCCTCTGCCCGATGTCCAGTCTTACTGTAGCCCTGCAATAAATCATCATCGTTTCAGTTGCACTGTTGCAATCTTTATTGACATTGATGCTTCTGCTGAGAACTTTTAAGTTAGAGTTAATTAGCTTTACATTTTTAAATGGTTGCTTTTGTAGGTAAAATAAACCATGTGTGCTTTAAATATTAATCTAGGTAACATTGACATTGAGGTAATTGTAAACATTTGACATTTTCACCATTTTAAATACTTATGACAAATGTTACATAAATATTTCAGTTTATACTTTAAAAATGCTGGGTTGTTTGTAAAATACGAACAAACCAACTTGATCAAAGTTGGGTTAAAAAGTTATTTAGCATTTTCAGAATGTATGAAGTTGTAAAAGCTGCATGCATAGTAATAAAAATGATGATCAAAATCTGTTTGGGATTTATTATTACAGAAAAGCTAACTTATTAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations