Genomic Feature

t614A

ID
ZDB-ALT-180813-3
Name
t614A
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
N├╝sslein-Volhard Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 23: 35547344 - 35547356 (GRCz11) (1) Details
Nucleotide change
CTCCACTTGCCGT/TTTAGGTAAGTTTTTTAGGTAAGCAAAAAAAATT
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
35 bp inserted / 13 bp deleted from position 1978 to 1990 in Exon 2 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TTTGTGCATATACATTTGATTAGTCAGTACTGAACCAAATCTGGTGATAACGGTCCAAAAACTAGTAAAGCCAAATATACAGTATATTTTATAGAAAAATATTAAATACAAATAAAAAAAAGACTAAATCAACAGAAGCACAACAATTAAAAGATTTAGTTGAAATTTTGTAGGTTGTCATTTTTTTGTGCAATATTTAGCTTAAATTTAATTGTATTAAATTTCTGAATATGTTTGGTGACTAAAATGTTATTTTAATAAATATATCTGTTTAATAAATCTGTTTTGTTTAAATGCACCAAAATACATTGCCTCTATTCACTGAGAAATAGATAAAAAAAATCTTGATTTTCAAAATGGGGTGTACTCTGTTATGCTGAGCACTGTACTTATTAGACAACATTTTGCTTGAAAATTCAGTTTGGGTCATCCCACATTCTAATATATAGTTCACTGACATTTTGTGCATCTTTAAATGCCCTGCTTACCTAAAATTGTTT
CTCCACTTGCCGT/TTTAGGTAAGTTTTTTAGGTAAGCAAAAAAAATT TTTGAGATGGTGCGTGTCCTTCGGCTCAGGCGCGCTCTCTGTCTTCTGCGCGCTCTCGTCGTCAGCGCTATTTTCCACCTGTCTCATGATTTCCATGATCCGTCTGAGCGTTTTCTCCACTTTGTTCGCGCTGGCATCGCTTTGTGCGGCAGTGCAGATTAACAATACGAGCCCCATTACCAGCACCGGGGCTCGCAGCGCGCGCATCTCTCCCGAAACCAGAGTGCGCGCACAGCCCAAGTCCAGGATCACGCAGTCTGGAGAAGAAGTGGCAGGGTTTATATGATAAACTTTTATGTTGGAAATGAGCTTTGGAAGCTTTTGCGATTTATTTAAAATAGAAGTCTTGCTCGATTTTCACTAGATTGGACACACCTACTCTTTCTTTTTATTGTCATTTTTGGTATAGCATCAGAACTGTGGCACTTGTGATTCGAATTTAAGACAAATCCAAAACTGTCTCTGGATTTTATTCATTGAGTGCCTCCTATCATGGGTTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations