Genomic Feature

t613A

ID
ZDB-ALT-180813-2
Name
t613A
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 8: 18464523 - 18464527 (GRCz11) (1) Details
Nucleotide change
AAGCC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted from position 1629 to 1633 in RefSeq:XM_003199060 in Exon 3 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
ACAATGCGCAATGGTTAGATTTAGGTCAAATCAAGGATGTGTTTATTTAAAACATTTAAAATTTGTATTTGTTTATTTTATATTTGGATATTATGCATTTATATAGTGTAGATATGTCGTGACTTGTACAAAAATCTGCCTATAATAACGCAGGACCACTGCGCAAATTTTGCCAAGTGCGCATTTACGCGCGTATCAACTTTTACTAGGCTATGCGACGATTTAATGACTTGCTTTCCTGTTTTGTTCGTTTGTCAGTCTGGAAAGCCATGCGGGCTGAGAAGAGATGGCACATCTTGTTGAGTATGATTCTTTTGCTCATCACCTCCAGCCAGTGCATGGACAGCAAGGAGGTAAAGGAGTCGGAAAGGAAAACTCTGCTTAATCTAATCCTGCAAGTGATCGGGGAAAAGCCCGCGTCCAGACGCGTCACCAGTGGCCTCTACTCTGTATCTCAAGATGCTAAGTTTTCCTCGCGTGAAAACACTGCACATTTGCCC
AAGCC/- GGACAACAGCAGACCAATAGGTAAGCTGATTTGAGATCAGGTGATAAATGTAATCCAGGGCATTAACTCCTTCCTGTTTCTGCATATCAAATGCACTTTTAACACCTAATCGCTGACAGCTCGTCATATTTTGTGTTGATGAATTGCAGTGACATTAACATAACCTGTAATAATTGGCTCAATGTTAAAAGTCCAGTTTAAAAAAAAAGCTGTGAAATTGGATTAAGGAACACTCTTTTGATCTACAGAGGGTGGTAAAATGAATGCTTATGGTCTTGTTAGGCAGATAACATAACGCTGAAATCACCAGCGTAGATCTAAGAACTGCTCAGAGAAAGTTTATAAGCTTGGGAAATCATGGAGCTAATTGTCACATGTAATGGTGTGCGCCTTTAGAAAACTGCTGGTGAGCTGCTGCATTTCACAAAAAAAAAAAAAAAAAAAGTGTGTGTGCCTGAAAATGTGCTTCATGCATAACTCTGAAACTATTTGGGTTGTTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations