Genomic Feature

b1279

ID
ZDB-ALT-180315-3
Name
b1279
Synonyms
  • 8-nucleotide deletion (1)
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Postlethwait Zebrafish Genetics Laboratory
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 21: 198441 - 198450 (GRCz11) (1) Details
Nucleotide change
CTTTGGGGGA/TG
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp inserted / 10 bp deleted in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TAGATATTGCTGGATGTCTCCATATAGATGACTGATCTGATCAGGTGTATCAGACCCTTCACAGCGAGACTGACAGCACATGTACATGAGTTTAGACGTGAGTGATCGGTGTTCAGAGTCTCAGGTGATGGCGGTGCCGTGTCCTCGATTAATGAATGGCTCCTTTTTCTGCGCCATTCCTGTGTGAACTCCTTCATTTCGTCACCTATCCTCCTTCGGTTTGGGCTTATCGTCTTTGCGACTGTGTAACCGCACGATAGAATTCATTGTGTTTTCCTCAATTCCACCTTTTTTCTCCTCCTCCTTTCCAACACCATCCGTTCGCTCTACATGAAAACAGTGTAAAGTATTCCAAGGCCAAGCCTGGCCAGCGTAGATAAATCGCAGCTTTCCCAGGCCGCCACAGACAACATCCACCGCTGCAGTCCGAGCTCCTCCAGCGAACGCTCCTGAATCCACAGACATGCTGCTGCGCCTCGTCCTGCTGCTGCTGGCCTTCC
CTTTGGGGGA/TG GATGTTTGTGCTCCATCCGTCACCTGAGGACCAGAGCCACAGGTAAGAGCATCCATCTACTGTACATCATTCTGCCTCAGGTGTTCATCGTGTGGGTGTTACACTATGAGGAAACAGCAGCAGAGAACAGGATAAGAGCTGTAGGAGTCGTATAATGGTGTGAAACGTGTGTGTTCAGTATATATTCAGTGTGTTGTGTCGATGTTCTGCCCTGAGCCGTGAGCCTACAGATGTTTATTCGTCCCGGTGTTGCGCAACAGCACAGAATGTGAAAACTCTGCTGGCACACGAGTGACCCTGAAGGAGAGAGTCATGAGATTAAACAGGTTAGCTGAAGAGCTGACCTTTCAAGCTGAGCTTGGGTCAAACACACACAACCCAATAGAGTGGATGAAGAAGAGTGTGTGTGTGTGTGTGTGTGTGTGTTTAAACCGTTTAGACTGCTGCTCATCAAGAGGGTTTGGAAGAGTTCCCATCAGACCGAGCGTTTCTCACAGCTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations