Community Action Needed: Please respond to the NIH RFI
Genomic Feature

mi4003

ID
ZDB-ALT-171115-698
Name
mi4003
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Shavit Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 1: 139234 - 139250 (GRCz11) (1) Details
Nucleotide change
TCTGCGAGAATGAAAAC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
17 bp deleted in Exon 5 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CAGCATTATAACACACCCAGTAGCATTATAACACACTCTGTCAGCATTATAACACACTCAGCAGCATTATAACACACTTCGACTGCATTATAACACACTGCATCTGTATTATGACACACCCCATCTTCATTATAACACACTCAGCAGCATTATAACACATTCTGACTGCATTATAACAAACTCAGCAGCATTATAACACACTCCATCAGCATTATAACACACTCTGTCCGCATTATAACACACTCAGCAGCATTATAACACACTTCGACTGCATTATAACACACTGCATCTGTATTATGACACACCCCATCTTCATTATAACACACTCAGCAGCATTATAACACATTCTGACTGCATTATAACACACTCTGTCAGCATTATAACACACTCAGCAGCATTATAACACACTCTATCAGCATTATAACACACTCTGTCCGCATTATAACGCACTCCGTCAGCCCCATTCACAGCTTTACTCATTTCTGCAGTGATTCCTGAAC
TCTGCGAGAATGAAAAC/- GGAGGCTGTGATCATTTCTGTGAGGTGATGGAGAAGAATGTGGTCTGCTCGTGTGCTAATGGATATGAACTGGCCCCCAACGGGAAATCCTGCCAGTCTCAGGGTGGGTTTAAATGTGAATGAGATGTTAATTAAATGATATCCTCCATATTATTATTAAGATAAATCCCATTTATTATCATACGGAGCATTATTACTGATGTATTGCCAATGATATCACCCGTCCCTGTTTTAGATCCATTCAAATGTGGCGTCATTTATCCAAAGAAGACCAGAAGCATCTTCTTCCACACGCCGAACATCACCGAAAGCGAGAACGAAGAAGAGACGGAGCTGGAGGCCACCATAGAGCCGGTCTACAACCACTCGAACCCACTGAACAACCAGACCGACAGCATGTTCGGGCTCCACGAGCTGGAGATTATCGAGGAGGAACCAATCCTACCGGTGGTGTCCACAGCCGGAGACGGGAGGATCGTGAACGGTGTGGAGTGTCCACC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations