Genomic Feature

sm10

ID
ZDB-ALT-170804-2
Name
sm10
Synonyms
  • smu3 (1)
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Yiyue ZHANG Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 6: 33978301 - 33978308 (GRCz11) (1) Details
Nucleotide change
GTGCATCC/CAAAGTCTTTTCAAAAGCAAAAGTCTTTTCAAGTCTTCAAAGTCTTTT
Variant Notes
the truncated Mpl protein lacking the two fibronectin type 3 domains and the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
48 bp inserted / 8 bp deleted in Exon 3 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
ATGTTAGGTGGTACTGTTATTTAAGTAATCATAAAGATGCCTGCCTTGTTAATTCTGTCATAGAAATAGCAGCTGTTGGAGATTTTCATATCTTGAAAATCTTTTTTTTTAAATGTATATGTATACAGCTTCCAGCACTCTAAACATCCTCAGTTTTTTTTTCAGTTATCATCCTCAGTTATCATTATGAGTAAAATAAGGGCATTTTATAAACCAACCCATCAGTATTTTAAAACTTTAATCCAACTGTTGGGTTTGTCCACATTTTGCACAATTTCTAAATTAATTTAAGAATTGCAGGAATCTCTGTATGCTAGATTATTTTAATTGATTGATTGATCAGTTATTAACTTTATTTATTAGCTAACTGGAAGTAAACTGTCTAACTAGCTTTTTCTTTATAGTAAATGAGCCAATCATTTAAATGAAATCTACAAGATGAAATGTTCAGAACTCTCACCCTTCAATTATATAAAGAAAATCATAGGACTTTTCAACAG
GTGCATCC/CAAAGTCTTTTCAAAAGCAAAAGTCTTTTCAAGTCTTCAAAGTCTTTT CAAAAGCAAGTGAAGTCTTCTAGATTCCTGGTGAAACATTTTGGGTCCTCATCCATAGCCAATAACTCTGAAAAGAATGAAAAAATTCTTGTAGCTAAAATACTAACAAAACGCATAGTTTTGATGCATGTATCCTTTTACACTTTTCTCTACTAAACGCTCGCTCAACATAATGTGTTGTATTTAACACTTTCCTCTTCAAAAACAGATCAGCTTCTTTGCAGAATGAACATAAAATACAATCATCTAAAATAAAGTCACCTGACTGGTGTTTCTTACCTGGCTTTGGTTGGCGAGGTTCTGAATTCACCTGTTTGTAAAGACAAAAATGTAAAATCCACCAGATGAAAACTGGATCCATGTTGATGGGGGTCCATACACAACACTTAAAATTAACGTCTAGATAAGATAGATTTGTGTCAAGTGCTTAATGTTTTTAGGAGAGGGCGGGGAGGTTGGTAACTGGTCATCTGAAGGGGCCCAATGAAATAGGAAGTGGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations