Genomic Feature

ya327

ID
ZDB-ALT-170626-4
Name
ya327
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Nicoli Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 22: 5307498 - 5307500 (GRCz11) (1) Details
Nucleotide change
ACT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
3 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GGCACAAATAGATTTGCTTAAACAACATGGAACAGGAAAATTAAGATTGCGTTGGTCTGAAAATAGCAACACGTCAGGAAAAACACGTCTTGCGCCTTATTGGGCCTGGTGTATAATAGGGCTCTTTATGGTTTCATTCAAACATTTAATCAGGTGTAAGTTTGGGCTGAGGATATAAGCCTTTTATTTTGGTTTATGTTTTTTAAGTTTGGTCTTAAAAATGACAAAAGTGTCCAAAAAATTAAGACTCTCTTTTTTATTTTACAAATTGAACACACCCAAAGATACGAGCAAACATACTGGTGTCGATATAGGCTCTTATGTCTTAAATCTAACCTTCAGTTAACTATAAATTGTGTGGAATTGCTTGAACTACAAAGACTTTGAACACAAGGTGTGGTGTCGTGACCATCCCTACAATTTGTCCAGACATATCCTCTCCGATTGTTCGAGTAATTGCGCTGGTGTGGTGTTGAGAAACACGACTGAGGGCTGTTCCC
ACT/- TGTGCCTGCTAAACTGGTATCAGTATGTTGATTTAGTGCTGGCTCAGTTCAGCAGGAACAGGTGTGAAGTCCTCTACTCTCCTCCAATCAGAGTGCGCGCACAAGCATGCTTCACTTCAGCTGGAATACATCAAAATCCGTCATCAGTGAATATAAAACATGCTTTCCGAGCGACCTTGATGAAATATGAATGATTAACAAGTCAAGGCATCGAGGATAATGAATGTTTTGCATACTGATGCTGAAGCTGAACCCATATTTTTAGCATTGCTCAGCACATGAGTGACCGAGGTAATACGTAATATTGAGGTGTTCCTACCCACATACAAATCTGATATACGGCAATAGATGAAAATTACATGTATACCATAGCTTACCGCTTCATATTTGGATTTCACATATATAAAATATGTCATTAATGCAGCATATATTTTGAAATATTGCCTAAAAAAGACTGCTTACATATATATTTTTTCAACCATTAAATATACAAATATGTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations