Genomic Feature

ia30

ID
ZDB-ALT-170222-2
Name
ia30
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with
Lab of Origin
Dalla Valle Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 14: 23798410 - 23798411 (GRCz11) (1) Details
Nucleotide change
-/TCGCT
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp inserted in Exon 2 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
ATACTAAAACAGTTTAGATGTTGTTCTTGTTGTAGAATTTAAATGGAAATTTAATGAAAAAAAAAACTAATAAATTGCAACAATGTTGCTTAGGACATCCAATCCAACATTTAATAAGTAATTTCTAAAGTAATGATATTAATTTTAAAAATATTTGCATGCTATATTCATCACTGTACTATAATAAAAGTTACTTAATATTTAAGAACTAAGCAAAAACACAAGATTTTAAGTCATATCTTTTCCAGTCCCAATTTGAACATTACACGAACATCGCATTCACCATTATTATCCAGAAGCATTGACCATTTCGGTGGTCTTGATGGCTTACCTGGAATAGGGGCTGCTTGAGAAGTTTTTGGAAAAGCATAAACTGGCCCTCTGCTGCATTCCACTGACATTCCCAAAGCCCTGGCTCCTGCTCCAACCATCTCCTGAAGAGGTCAGAGGGGTGTACATGTTAAAGTCCGGCTTCTGATCTTTCTGCAGACCGACGACAGC
-/TCGCT TGTGGGCGAGCTGTTCCCAAAGAGGAAGCTCTGTCCGCTTGAAGTGGTGACCCCGCATATGTTAATGGGGGTGCTGTGGAGCCCTCCTTGACAATAGCTCGCACCGGTGTTCTCCTGTTTGATGACCCCTGGGGTGCACAGCTGGATTATAGAGTCTTTCTCCACCTTTATATTGGGCAAGATGCTGGTGTTGGCTGTGCTGAGGCTGGAAGAAGCTGTGCCATTGAGCGTGTTGCTCCCGGAAACCGCAGCCTTCGAGTCCCTGTCTAAATTTGTCGGCAGCTCTGAAAGGAGAGCATCTTCACCTATGGTGGAGAGAAACGCATCGTCAGCAACGTAGAAGTCTGATGGCGATCCATCCAGCTCAAAGTCCTGCAGGAGGTCCAGAGTGTTGTCACTAAAGAGCTTATGATTGCCAACATCAACATCTTTCCCAATGTGTCCAAAGGAATCTTGGTCAAGGTCCATATCGCCTTTAATCATGGGAGAAAAGTCCTCTGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations