header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-170209-2
Genomic Feature: sz1
Synonyms:
Affected Genomic Regions: dhx33 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-dhx33
Lab Of Origin: Hanbing Zhong Lab
Location: Chr 5: 1972380 - 1972390 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 11 bp deleted in Exon 3 (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
CCATGTTGCTTCAACACACCTGCGAGGATGTTTCTAGAAAGCCTAGTAAGAGCTTGATTAGCTAGCCCAGGTGTGTCTGATTGGGGTTGGAGCTAAATTTAGCTGGACACCGGTCTTTCAGGACCGAGTTTGAGCCCCCCCTGCCCTACACCATACTAATGAATTATTATTGTAGTCTATAACCAGACGTTTTAGTCTCATTGTCCATTCATTGTTCATTGTTTTATTTTTCATGTTATACAAACCAAATCTGAAACCCCGCACCTCGGTCTGCATCATCTGAATGATTCATGAGTGTTTCTGGTGTTAGGTGGGCTACACGGTGCGCTTCGAGGATGTCACATCACCAGAGACCAAGCTGAAGTTCATGACGGATGGGATGCTGCTGCGCGAGGCCATTGGAGATCCACTGTTACTGCGGTATACTGTGGTGATCCTGGACGAGGCTCACGAGAGAACTGTACACACTGATGTGCTGTTCGGTGTGGTAAAGGCCGCGC
AGCGCAGACGC/-
TTGGAGCAGAATAAAATACCACTCAAGGTGATTAACCAGCACTGCATTACGGGGACATGCGTTTTCAATATGCGCAATAAATATAAGTAGATGGTCAATTTATTGACAGAGGATGTATGCATGCATGTATGTATGTATGTATGTATGTAAGTATGCATGTATGTATGTATGTATGTATGTATGTATGTATGCATGTATGTATGTATGTATGTATGCATGTATGTATGTATGTATGTATGTATGTATGCGTGTATGCATGTATGTATGTATGTATGTATGTATGTATGTATGTATGCGTGTATGCATGTATGCATGTATGCATGTATGTATGTATGTATGCATGCATGTATGTATGTATGTATGTATGTATGCATGCATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGCATGCGCATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGCAT
OTHER sz1 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous dhx33sz1/sz1 dhx33 ♀+/- ♂+/-

CITATIONS  (1)