Community Action Needed: Please respond to the NIH RFI
Genomic Feature

rw0323

ID
ZDB-ALT-161010-4
Name
rw0323
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yoshihara Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 15: 5351656 (GRCz11) (1) Details
Nucleotide change
A/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
1 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
TAGCACCCATTTGACCTTAAACAGTAAGGTCTGTTGAGATTGAATAACTTCTTTTGTCTCTCCAAAAATGAACTGGCCACAAGCCAAACCCATTTTGGAGAACTACAGCAAACCGCAAGTAAAATAATGGTAAGTCATTGTCCTAACACTCTATCAGGGGAGGGGAGTTTGGGATATTTAAAGCAGAGTGCCTTAACCTAAATTAGAAGAGGGGGGTAAACTGCTGGTTAAAAAAACACAATTTAAAAGGCATGTCAGCATGTGTTATAGAGTTTAGGTTTAATTTTACAGACATGAAAAACAAGAGAAATATATTTGTTGATCTAATACTTAATTGATCCCATCAATGCAACAACATCTCAGGATACTTTGAAATGTAATTCTAAAGTCTTGCTTAACTTTATCTTAAACTGTTTATTTCTGCAGACATGTTTTCTGTGCATTAACTGTAACCAGTTTTGTCTTTACAGTGACCTTTGATCTAAGAAATGGAGGACAAA
A/- CGTTCAACATCTCTTATCAGGAGTTCTACTTGATTGGGTTCACGGATCTGCAAGACTATCGGCGATATCTTTTCATTCCTTTTTTCCTCATCTTTGCTTTCACATTGTTTACTAACTCAATTATAATCCTGGTGATAGTGAAAGAAAGCAAGCTGCATGCGCCCATGTACATTCTGATTGGGTTTGTCGCAGCTCTTGGGTTTTTACAACCAATATTTGCTATTCCAAGAATATTAATCAGCTTTCTCTTTGGTAGAAATATGATTTACAAAAGTGAATGTCTTGTTCAAATGTTTTGTCTGCATATGGCAGGTTGTTTCCAGTCGACGGTTTTGGTTGCGATGGCAGTCGACAGATTTTTCGCCATCACATTCCCCTTACAGTACCACTACTATGTTAACTTGAAAACATCATTGATATTCGGTTTGGCTCTTTTTTTGCGCAACTTGGTGGTTGTTGTTTCAATGGTGGGTTTAATTGCGCCACTCCAATTTTGTAAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations