ZFIN ID: ZDB-ALT-161003-16150
Genomic Feature: sa38715
Synonyms:
Affected Genomic Regions: fgfr1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 51486049 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
ACATGAAAACATTATAAGAGAGTGAAAACCTCAGCAGATATTCTGACTCTGATTGGCTGTTTTTCATCTAGACTCCACCTATTAGTCTTTATAGCTCAGCTCTGGGTTCAGCTTCAGCCATTAGCAGAACAGCAACTACGTGGGAGGCGGGGCTAAATACAGTAAGGCCTTACCTGATTGGTCAATCAACAACCAATGCATAAAATAAATGTATTTGATCACACAAGAGTGCGATACTTCTATTGCATGTACTTTTATCGCGATAATGATAATTTTGTGATGTATTGTGTATTCAGTTGCATTCTCACCTGTAACACTGATATTGAAGTATTCTGTATGGTTGCTGTTGAGTCCCTGAGCAAAGCAAGCATACAGACCAGAGTCGGTCGGCTCTACTTTCTCGATCTCCATCTGATCGTTGCGCAGGCGTGTGTGTTCTCCGTCAACCAGTGGAACGAGGTCCTTGGTCCAGGTCACTTTCTGTGTGTCCTCTTTAGCTT
T/A
ACAGGACAGCTCCAGTTTCTCTCCTGAATCCAGAGTGTACGATGTGGGCTCAGCCGGGGCTATATCAGGATATAAGAAATTAAAGTGGTTAAAACCACAGCAATCCAAATGATCCATTTCTACAGGATTATAAGTAGACCTAATATGCAAAATTCGCTTTTATAAGGGGTTTAAACAGTTCTGTGGGAAAAAGTGTGTAAATATATCCAGTCTCTAATCGTAAAAATTAATTCTATTCTTTATATTCACACGTGATTAAAACAGTCTGCAGAAACACTTTGAATGAAAGCCCCACCCATTAGTGACCATCTCTTCCTCATTAGCATAAACAGCCCTGAGTGAGAAGCAGGAGTCTAATTTGATTGACATTCTCCCTTTGTACGTGTCATTCGAGTGGAAAAGCCCCGCCCACTAGTGACCATCTCTCCTTTGTTAGCATAAACAGCCCTCAGTGAGAAGCAGCGGTCCAGTTTGATTGACATTCCTCTCTGCATGTGTCA
(1)
OTHER sa38715 PAGES
ZMP:sa38715 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous fgfr1asa38715/sa38715 fgfr1a Unknown
Complex fgfr1asa38715/sa38715 ; fgfr2sa30975/sa30975 fgfr1a, fgfr2

CITATIONS  (2)