Genomic Feature

zf660

ID
ZDB-ALT-160915-19
Name
zf660
Synonyms
  • m1 (1)
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Zhou Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 15: 15383912 - 15383913 (GRCz11) (1) Details
Nucleotide change
-/ATAA
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp inserted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AATGAGGTCAAACTGAAGAACCAATGAGATTCATTTTTGCGGATAACGCATACATTTGAGCTCCCGCAACAACCAATGAGATTTGTTCCTGTGTCTAGCAGGTGAAGTTGAGCTTTCAGATGGTGAGTGAAGCCTAATTGGAATAATATAAAGCGAAGATGTCTTTAAAAAAAAAACTATTAAACCACTCAATTGTTTTGTGCACCCGAAGTGAAAACATCTTACCGACACCATGAGGGTGAGTAAACAGTTTATCAAAACTCAAACCCTAAAATAATATAACAGCAGCAAATACACACAGGTCTTCTTTATGGTTCGTTTTATTACTTCAGTTCCTGTTCCATAAACAATTAGTTAATTAATGTACAAGTTAACATACATAACGTTACATGTGAGCACATAAAAAAATGTTCGAGAGCAAAATCATAATTAACACTTCACAAATTACACGTTCATATTCAGCATCAAGACTGTCCATCGCCGCCAACAGTACACTCATCC
-/ATAA ATAAAGTAGGAAACACTACACTGTGTAGAGAAGTTTAGTAGTGCTGTCTACTTTATGAGTGACTGCACTGTACCTCTGACCTTCCCGCCTCTTCTCGTCTTCACGCTCCAGTCGACACTTTTACACGCTTCCTCTTAACTCCATGTGCTCCGAATGCGCGTTTTACACCGATTATTAAACCTGTGAGAAAGCAGAACAAACTGTAGTGGTTAAACATGTCAAATACTATTAAAATATTAAAATAAGTTGAGCTGCGTTGGCTTTTCTTGTTCATAGTAGTCACCACAGATCGTGAGGTGTTTACAATTACTCTTTTTTTTTTACTGTTATAGGTAAAAATGAAATATGCTATGTGTAATGAACTATTTTAAAAGTGCATAATGCATAGATCTTCCAGTACTGCTGCTACCTTATTTGTAAAAATGTGTTTAAGATGAAATGGCTTCCTTTTGTATCAAATGTTTATTTATTGTAATGCTATTTACAGCTACTAGTAAAATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations