Genomic Feature

zf654

ID
ZDB-ALT-160915-13
Name
zf654
Synonyms
  • m12 (1)
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Zhou Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 5: 3170786 - 3170790 (GRCz11) (1) Details
Nucleotide change
ACAGT/CCTC
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp inserted / 5 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TTGGCTCTTTTTGACAGTAAAAAGCTTACTCATGCCGATCAAAATGGCTGCCGTCTGATATACAGGAAGACGTTTGCGCTGTGCATGAAATGGCGCATTGCATATATTAAGGCTTTTGATTTTATTCAGTGCTGATTTACTTTTAGTTGATGCCTATTGCATAAACTTTGATGTAATTTAAACAAATCATGTGTGGCAATGCATTTGCTGTAAGCGTCTACATAACGCACACCACCGATTATTAATCATAAAGATGATTCACCCATCCATGCATGTCTTATGTTAAAAAATATAAATTCATTTTTTTTTTATAAAAAGCTGTGAGTTTGAAGTGTTTGTGTAGTTTGGGTGGGGTCCAGAAGTGTGTGTGTGTGTGTGTGTGTTTATGTGAAGGAGGAGTCCGAGATGTCTGCTTTTATCAGGAAGTCCAGAAACATCAGGACAAAAGGACGTACAGTGCAGTCATCCATAAAGTAGAAAGCACTACTAAACCCCTCGCC
ACAGT/CCTC GTAGTGTTTCCTACTTTATGGATGAGTGTACTGTTGGCTGCTGGGAACACTTCGTGACGACTGAAACCAAAGGAAAAGAGGAACTGGCTTTGTTTCGTAAAGTGGTGCACGTCTCATAGTGTCACAAAGCACATCCACGTGAGACGCGCACGCTTGGGGAAAATAAAGCCACGTTTCTTTCAACTGGCTATTCAGCGAGTGCATGCATGCTGTTCACACTTTAATAAAGCTTTCAAAATAAATCAAACGCATTTTTGTGTCTCATTTTTATGTGCACATGTTCTTTATTTATGTCCATATTACACTGTTCAAGTCGCATTTCAGGATGACATTTTAAGAAGATTCAATAGTGGCACTATAAGATGATTCAGTAGTCATGTTTAGAGATGATTTGGGAGTCTCATTTCAAGATGATTTTTTGATCACATTTTAAGAACCTCTAGTTGCATGAAAAAAAAGTTAAAAAGATAAAAAATTTTGTTTTGTGAAAATATATTTTA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations