Community Action Needed: Please respond to the NIH RFI
Genomic Feature

zf559

ID
ZDB-ALT-151013-2
Name
zf559
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
PKU Zebrafish Functional Genomics Group
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 5: 19443095 - 19443102 (GRCz11) (1) Details
Nucleotide change
TCCCTCCG/-
Variant Notes
Tong et al (2014): 8 bp-deletion in exon3 of kctd10
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted in Exon 3 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TGTATCCATTAGACCTACAGAGTAGCATTAATGCATCCTGAAGTAAAGTAAAACGGATAAACGTCGTGTTTGCTAGCCTCACGCATCACGCACTTGTCAGTCAGTCAGTCAGTCAGCACGTCACCTTAAAGGGTAAATAAATGACGCAAAGCACTACTACTGTCACAGAAAAGTTTGCGCTATTATAATTCACTTCTACTTTAATACATTTTGGTGCGATTATTACCCGTTATTAAAAAAATAAAATGTCTTGAATGAGAAGCTATAATGTAGCCGTGGCGGGATGAATTTTGGCATGGCGCACTGCCACGGAAGAATGAATGTAGCGGAAACCATGAGATAAACAAACAACTTTGGAAAGTTTAAATGAGTTGTGGGTTAGCAAATTTAAAGTCAATTTTCATTTTTGTTGTGTGTACTTTACCTGCAATGCTGCTTGACACTCATCTACCAGGCCCTGCACTAGGTAATACTTTGCCTCTGCCAGCAACTCCTCAGTT
TCCCTCCG/- GCTCTCAGGTAAGGGGACGACTCCATCTCTCAGGTAATTCAGGATGGTCCCAAAGTGCTTCCCACACCTGTCAATCAGAATCCAGCCTAGAGGAAGATTAGATGTAGAAAGTGTGACCAGGATGTTGCAGAAGCACACATTTGGTTCATTAAACACCTTTTTTCAGGAGCTATAACAGTTCACCTACCTTCGCTATCAGTGAGGACCTCCATACGGCCACTGAACATGGCCTTTAGCATGGTGTCCTGCTTGGTCAGGGTCTGCATGGTGGTGTAATACAGCGCTCCACCGACATTCAGCTTCACATATTTGGAACTGGGACTGGACCCCTTAAAAGAGGTGGTCCGTGTTGTAGCTGCCGGCACAGCCGAGCTCACAACACTTTCTCCTGACATCTCTTCCTGGAATCAGACAGAGTTGGGAACGGTGACTAGGAGGTTTGGAATAATACAGGCCATACATAAACTACAGAATACACAACTTTTCTCAGGAAATCAATG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations