Genomic Feature

zf558

ID
ZDB-ALT-151013-1
Name
zf558
Synonyms
  • 34c (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
PKU Zebrafish Functional Genomics Group
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 19443069 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
Tong et al (2014): spontaneous recessive mutation, A-to-T substitution at  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>T in Exon 2 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Lys>Stop at position 113 (1)
Sequences
Flanking Sequence
TTAGATTTGCTAGGAATATTTATGAATGTATCCATTAGACCTACAGAGTAGCATTAATGCATCCTGAAGTAAAGTAAAACGGATAAACGTCGTGTTTGCTAGCCTCACGCATCACGCACTTGTCAGTCAGTCAGTCAGTCAGCACGTCACCTTAAAGGGTAAATAAATGACGCAAAGCACTACTACTGTCACAGAAAAGTTTGCGCTATTATAATTCACTTCTACTTTAATACATTTTGGTGCGATTATTACCCGTTATTAAAAAAATAAAATGTCTTGAATGAGAAGCTATAATGTAGCCGTGGCGGGATGAATTTTGGCATGGCGCACTGCCACGGAAGAATGAATGTAGCGGAAACCATGAGATAAACAAACAACTTTGGAAAGTTTAAATGAGTTGTGGGTTAGCAAATTTAAAGTCAATTTTCATTTTTGTTGTGTGTACTTTACCTGCAATGCTGCTTGACACTCATCTACCAGGCCCTGCACTAGGTAATACT
T/A TGCCTCTGCCAGCAACTCCTCAGTTTCCCTCCGGCTCTCAGGTAAGGGGACGACTCCATCTCTCAGGTAATTCAGGATGGTCCCAAAGTGCTTCCCACACCTGTCAATCAGAATCCAGCCTAGAGGAAGATTAGATGTAGAAAGTGTGACCAGGATGTTGCAGAAGCACACATTTGGTTCATTAAACACCTTTTTTCAGGAGCTATAACAGTTCACCTACCTTCGCTATCAGTGAGGACCTCCATACGGCCACTGAACATGGCCTTTAGCATGGTGTCCTGCTTGGTCAGGGTCTGCATGGTGGTGTAATACAGCGCTCCACCGACATTCAGCTTCACATATTTGGAACTGGGACTGGACCCCTTAAAAGAGGTGGTCCGTGTTGTAGCTGCCGGCACAGCCGAGCTCACAACACTTTCTCCTGACATCTCTTCCTGGAATCAGACAGAGTTGGGAACGGTGACTAGGAGGTTTGGAATAATACAGGCCATACATAAACT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations