Genomic Feature

a142

ID
ZDB-ALT-140611-7
Name
a142
Synonyms
  • allele 3, allele 28 (1)
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
TALEN 
Lab of Origin
Schier Lab
Current Source
Other Pages
Note
TALEN-induced 12 nt deletion and 5 nt insertion generates frameshift allele lacking the mature Toddler peptide (frameshift 2 amino acids after the signal peptidase cleavage site).
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 1: 19673494 - 19673510 (GRCz11) (1) Details
Nucleotide change
TGTTTTGTACCATGTTT/TGTTTTGTTT
Variant Notes
TALEN-induced 12 nt deletion and 5 nt insertion generates frameshift allele  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp inserted / 17 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
None
Sequences
Flanking Sequence
TGTTCACAAGAGTCGTTTGCTCGTGAATCGGTCTCACATCTTTGTTTCACGTGCAGTCCGCAACACACAATTCGCAAATTTGAAATTCAGACTATAGCTATACAGTTCATTATGGCATCAAAGACTCCATGAATAACGTTTACCATTCTTTGCATATAATTTTTCAAATACAAATGAAAGTTACATTGGGTTAGAAAGCAAAAAGGTTCTTCCTCAAGGAGAATCAAGTGTGATTTAGACTACAAAATAGTCTAGATATATGGTTGACTGAAATATTTTCTTTTTAATCGACGTGACTTAATATTTTACATAGGTTTTTTTCAATCTATAAATTACAGGTAGGCTAGCCTACAACCGCCAACAGAACATTTTAAGTTTGTCTAAATGTTCGGAGCTTTGATTCAGTTCTTCGCCTCACAACATACTCGAATCGTTTGCCTCATGTTGTTTAGCCTAAAACTTGTCTATTTTAAGATGTGGTGGTGTTGAGTAGCTTACCG
TGTTTTGTACCATGTTT/TGTTTTGTTT ATCTGCGCTGATGAGGACCAGCACTGTCAGCAGCAGCAGCAGCAGATACAGCGGGTGGAAGAATCTCATGGTGATGCTCAGGGTGGTTTGGTCCGCGGCGCAGACTCGACTCTCCTCACAGGATGTCCGCGGTTCCTCAGACGATAAATTCTGTCGGATGTGCAGGTAACGGACTGTAGAAATCCTCTTATGTGTCTGTCGCTCTCAGCAAGTGTTCTCAGATCTCATATAAGTTGAGTTATATAGAAGACACGCAGTTGTAGCCAGCTCTCGGTCTCTCCAACTTTTTCAAAGTTTGAGAGGGCGATATTCACTCTCTCTTCTCTCTCTGTCCTCTGAGGGATGGATAGATAGACAGATGACCTGATGAGTGGGAATGTTCAGTTGAGACAATGTAGTTTCACCCCCTCTTTATACAGACAAGAGAAAGGGGAGGAGAGGGCACGACAGAGGAGGGGTATGAAAGACCTAAAACTGGGTGGGGACAGGGCATCACACAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations