Genomic Feature

a141

ID
ZDB-ALT-140611-6
Name
a141
Synonyms
  • allele 7 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Schier Lab
Current Source
Other Pages
Note
TALEN-induced 4 nt deletion generates frameshift allele lacking the mature Toddler peptide\n(frameshift 2 amino acids after the signal peptidase cleavage site).
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 1: 19673502 - 19673505 (GRCz11) (1) Details
Nucleotide change
ACCA/-
Variant Notes
TALEN-induced 4 nt deletion generates frameshift allele lacking the mature  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
None
Sequences
Flanking Sequence
AGAGTCGTTTGCTCGTGAATCGGTCTCACATCTTTGTTTCACGTGCAGTCCGCAACACACAATTCGCAAATTTGAAATTCAGACTATAGCTATACAGTTCATTATGGCATCAAAGACTCCATGAATAACGTTTACCATTCTTTGCATATAATTTTTCAAATACAAATGAAAGTTACATTGGGTTAGAAAGCAAAAAGGTTCTTCCTCAAGGAGAATCAAGTGTGATTTAGACTACAAAATAGTCTAGATATATGGTTGACTGAAATATTTTCTTTTTAATCGACGTGACTTAATATTTTACATAGGTTTTTTTCAATCTATAAATTACAGGTAGGCTAGCCTACAACCGCCAACAGAACATTTTAAGTTTGTCTAAATGTTCGGAGCTTTGATTCAGTTCTTCGCCTCACAACATACTCGAATCGTTTGCCTCATGTTGTTTAGCCTAAAACTTGTCTATTTTAAGATGTGGTGGTGTTGAGTAGCTTACCGTGTTTTGT
ACCA/- TGTTTATCTGCGCTGATGAGGACCAGCACTGTCAGCAGCAGCAGCAGCAGATACAGCGGGTGGAAGAATCTCATGGTGATGCTCAGGGTGGTTTGGTCCGCGGCGCAGACTCGACTCTCCTCACAGGATGTCCGCGGTTCCTCAGACGATAAATTCTGTCGGATGTGCAGGTAACGGACTGTAGAAATCCTCTTATGTGTCTGTCGCTCTCAGCAAGTGTTCTCAGATCTCATATAAGTTGAGTTATATAGAAGACACGCAGTTGTAGCCAGCTCTCGGTCTCTCCAACTTTTTCAAAGTTTGAGAGGGCGATATTCACTCTCTCTTCTCTCTCTGTCCTCTGAGGGATGGATAGATAGACAGATGACCTGATGAGTGGGAATGTTCAGTTGAGACAATGTAGTTTCACCCCCTCTTTATACAGACAAGAGAAAGGGGAGGAGAGGGCACGACAGAGGAGGGGTATGAAAGACCTAAAACTGGGTGGGGACAGGGCATCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations