Genomic Feature

hu2124

ID
ZDB-ALT-120725-1
Name
hu2124
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
den Hertog Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 68794546 (GRCz11) (1) Details
Nucleotide change
G/T
Variant Notes
hu2124 allele contains a C>A transition at position 185, resulting in a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>A at position 185 in GenBank:X97329 in Exon 2 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Ser>Stop (1)
Sequences
Flanking Sequence
GTCTGAAAAAAAAACATTTTATATTTTAAAGAAAGCTGACTTCCATATAGTATTCCAGGTTGTGTCTTCAAAATATCATCTTATTGTGTTCAACAGAATAAAGAAACTCAATAAAGATTGTAGAATGAGTAAAAGTGAGTAAATTTAAAGTTTAGGGTGAACTATTCCTTTAAATCAGCTTGTTTAACTTCAATAAAACTTAAATAAGCTTACTTGTATAAGCTACAATTGACATAAAAGCATATGTTGTTATAACTCATTAATTATACACCCTTTAATTATTATATTACGCTTTACATACGTGTAGACAGGAAACTTACCTTGATCTCTCGCAGTCGCGGTTTTAGTCCTAATATACTCAACAGCCAATTCCAGAATTTCAGCCTTCTCCAGTTTAGGGTTTTGAAGTCGCTGCAAGGAGTGAATGTAAATGCATTATGCTGCTAAGCCATTTCAGTGTTGTTTAAGTGCACTTTTAAAACTTTATATGTTTTATTACC
G/T AATCTAAAGTATTATCCAGAAGAAGCGTTCGCAGTTCTTCCAAACGCTGGTTGATCCGGTCTCTCCGTTTCTTCTCTATAACCGGTTTTAAGATCTAGACGGAGCAAGTTGTACTTTTAATTCAGGCTTAATTAAACAAAATGAAAATGTATTGTGTTTAAAGTCCAACTAATAGAGATGGCTAAATCATAGATACATTGAAAAAAAGATCAGCTATACTTTAACAAAAGTGAGTAAAATTTAATTTAAACAAAATGAGTATCATTCATTGACTTAACTTATAATTATCCACATAAACTTGTTTACGTAATAATTAAAATGCAATGGCTTGACTCTCTTTTTTTAAGGTAAAGTCAATTAATCCCTTTTACAGTGTAGCTACAAGAGAAAGAGCGTGGACTTACTCGTTTGGTTGGTCTTCGACTTGCCATTTTTGGAGTAACCATGGCTGAAAATCGGAAGAAGACGATACACCTTCAGTGTTGTATTCCCGCTGATCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations