Genomic Feature

hu5935

ID
ZDB-ALT-110802-4
Name
hu5935
Synonyms
  • wickham (1)
  • wkm (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Bakkers Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 25770594 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>T at position 985 in Exon 3 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Lys>Stop at position 329 (1)
Sequences
Flanking Sequence
TCGCGGATGATAAAAAAGGGTCTAAAAACATCACGTTACGAACACGGCACATTTTAATCGAAGATGGCGGCGCTCTCCATATTGGGGCTCCAAAATGTCGATATCGCTCTCTGGCTACTATCACCCTTGTTGGCCGATCAGATGAGACCGCCGTGACTGAGGTTCCAGGGATGGGCCGCAAGTTTTTAGGTGTGAATTCTGGAGGAACTCTGGAGCTTCATGGGTCAGAAAGGATGTCTTGGACCTTCCTCACTCGCACCGTGCCTGCTTCAGGATTGGCTACGGGTGACCACGCCTTTCAGAAAAACTTCAGCCGTGGAATTAACCTCCGTGTGGTTGATCAGGACACGGCAGAGGTTCTGGTTAATGAGCGCTTCGACACGCATGAATCTCAAGATGACAGTAAAAGGCTGGGTGAGCTGCTGAAGGCTCTGCCCGCAGGACGCATCGTTGCACTGGCCACTGGAGATTCTGCGGTGAAGAACCTGGTGTTTGAGACC
A/T AACAAACCATCCACGATCTTCTAGGGAGCAACTATATCAGTGATCTCAAATACAGGTGAATAGCAGAGGCCTTTTAAAATCAGAGGGCTTTATACTCTGTTCTTGTTGTTATTCTTAACACTGCTTTTAATCCTTGGTTTAAATAATATTTCACATTTGTAATTTGAGATTTAATAAGTGGGTTGAAGTATAAGTTGGGGAGTTAAGGCCAAGGTGCGAATTACAGGGGGGTTTAGGGGATGCCCCCCAATTAACACATGATCATTCAACAATCTGAAACCAGCAGATCTAGAGGACCAATAGACACTGTAAGTGTTCACAAGGCACATTTACATTTATGTCTACAAGTAGCCTTAAAGTAGAGTACAATTAGTATAATTTTGTATAAATCTTGTATAATTTTACCCACAGTAACTACTGTATGAGCTACTCAGAAGTTATTTAAATGTACTCACAAAATATCCCTCAAATCACTGAAAACTATTTAATAAATTAAATGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations