Genomic Feature

hu4800

ID
ZDB-ALT-110802-3
Name
hu4800
Synonyms
  • wickham (1)
  • wkm (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Bakkers Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 25781558 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
GTG>GAG, at 1277bp from the predicted start ATG
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A at position 1277 (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Val>Glu at position 426 (1)
Sequences
Flanking Sequence
TAGCAGTATAACCAGACTCAGCAACTGGTGTGTGTGTCTGTGCTGCTTGTAAAGTCTATGTAATCAGTTCATAATGATCCTCCAGCTGTGTGTGAAACAGGAACAGGTGTGTGGGTTTGGTGCGTCACAGGATTTATAGTTCTTTTGGTGGCAGATTTGCAGTTCTCCAGCGATTTGTATGGACTAGGTCACTGGTGATTGTGACAATAACAAACAGCAAATGTCAATTTTTGAGTTTGTGTATTTTATGTGTTTGAGGTAAAACTTGGGCTAATTTGCATTTAAATAAACAAAAACAAAAATAAACAAAAGTTTTTTTTTCTTCTCACCTAAAATGTTGTGTTTACAGTGTGGCGTAAGGATCTGTGAGTACATGAGATGAAAAAGACAAAAAAGAAAACCCTTTTTAAACCTTCACTGTTTTTTGCCATAAGGTTACCCTACTACAGGCTTCCAAGTGGATGCAGTGGATAAAGTAGTTCTGAACCTGCAAGATGACG
T/A GAGCAGCTGGAATCCGGGTGATCGGATTGTGGTGGCTAGCACAGATTACTCCATGTACCAGGCAGAAGAGTTCACCCTGCTCCCCTGTCCAAACTGTAACAGAAAGCAAGTTCAAATTCAAGGTGAGATGGCTTTGGTTTGTTGTGTTAATAATTTACAGCATCTCTGCTCTCAATCTTGCTGTCAATTTTCATGAAGCCAAGTTGACAGTGTCTATGAGTTTGCAACAGGAAAAGGGTGAGGACTGTTTACCAGAGTCCCATAAACAAACTTGTCATTTTTGACCATAGGCCAGCAGTGGCTGTATAGATAATTCTTCCATCATGTTCTCCACCCTGTTCAAAATTCAGATTTTTTGTCACTAATTGCTTTACAGTGATAACGTCCCAACTGCTCTTTAGGGTGTACTGGAATTTGTACACATACATGTTTGTGTATGTGTTTTCGTTAGATAGAAAGAAATCTCTTATGCTGATCAAGGCAGCATATAATTAATTAAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations