Genomic Feature

vu242

ID
ZDB-ALT-110414-1
Name
vu242
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Lila Solnica-Krezel Lab - Vanderbilt University
Current Source
Other Pages
Note
C to A transversion, predicted to change the tyrosine residue at amino acid 1031 to a premature stop codon.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 1: 54244131 (GRCz11) (1) Details
Nucleotide change
C/A
Variant Notes
C to A transversion, predicted to change the tyrosine residue at amino acid  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Tyr>Stop at position 1031 (1)
Sequences
Flanking Sequence
AATGTATCAGAATTGGATGAATCATTAAATCAAATCGGATGAATCGGATTTATCAGAATTGGATGAATCAGAATTCAATGACTCAGAATTAGATGAACTGGATTAATCATAATAGGATGAATCATAGTCATAATTGCCTGAATCATAATTGGCTGAATCAGAATCAGATGAATTGGATGAATTAGAATTGAATGAATCAGAATTGGGTGAATCAGAATTGGATGAATCAGAATTTAATGAATCAGAATCAGTAACACAGAATCAGTGAATCGGAATGAATGTGTGTTTAGGCCTGTGTGTGTGCGTGCAATCTGCTTCAGCACTGATTGACTGTCAGGTTGTGAGTGTGTGCTGTGCCCCGTCCTGTGCAGGATGCAGACGTCCAGCACCACCTGCAGTCTGGGCTCAGCTGATGAGAACGCTGTGATGCAGGCGGACGACGCTCTGAAGACAGTCCATCTGGAGCTCACAGAGACCTGCCTGGACATGATGGCCAGATA
C/A GTCTTCTCCAACTTCTCTGCTCTGCCCAAGAGGTGCGCGCAGCCATCGTAATGATGACTAGATGAAGAAATTATAACAAATGGCTCAAATTAATTAATTTAAAAATGAACTCGAAATTAAAACATTGATTAATTATTTCTGTGGAACATTGTTACAGGTGTAGAGCAATATATAAGATGCAGTCCATCTCTATTGTAGTGTGTTGTTTTCAGCAGGAGAAAGGCAAGCTTCAAGTGTTTTCTGTGTGTGTTTTTCTTCTCTCAGGTCTCCCATCGCTGATTTCCTGTTATCTGGTGGTCCTAGTATGACGTGGCTGGTTGGGAATAAGTTAGTGACCATAACCACCAGCGGCGGCTCGCGAACACAAGCTCTTCTGGGTCTGGACATGACAGAGAGACATGGAGGAGGAGAAATGACCAGGTGATCGATTTATTCACTCGTCAAATTACTGGTCTGAGACCCATTCGGCAGATGAAAGAAGTCCGAAAACTAAACATGAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations