header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-080520-3
Genomic Feature: sa56
Synonyms: sa0056 (1)
Affected Genomic Regions: ptger4a (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 912651 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATCGTGGTGCTCTGCAAGTCCCGCAGAGAGCAGAAGGAGACCACCTTTTA
T/A
ACCCTGGTGTGCGGGCTGGCGGTCACGGATCTCCTGGGCACCGTGTTGGC
(1)
OTHER sa56 PAGES
ZMP:sa56 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ptger4asa56/sa56 (TL) ptger4a ♀+/- ♂+/-
Heterozygous ptger4asa56/+ (AB) ptger4a Unknown
Unknown ptger4asa56 ptger4a Unknown

CITATIONS  (8)