Genomic Feature

t21384

ID
ZDB-ALT-070716-5
Name
t21384
Synonyms
  • HA327AA (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 22: 16543397 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Lys>Stop at position 183 (1)
Sequences
Flanking Sequence
ATGCTTCCTTCCCTGTGATGTCGTAAACACCACATTGCTTTTCGGTTCCTCTGATCTGATTGGATGTTGTGAGCATGTTATTTTTGTCTGTAACTTGGTAACAACCAGTACAGCAACATCAAATTATCGTCTTGGAAGCAGACATTTATGTGGGTCCAACTTGTCATGGGCCAGTATAAGATTCTGATGGTATGATAACCTTAAACATACATATCAAGGTTTCACTGTATCACAGTATTGAGATTACTGCTCTAAAATATGTATAAAATAAAATATATATAAAATATATTTATGCACATTTTCAACATTAATGCACATCTTGGCTTTTCCATCAAACAATTTTTTTCATGCGCATATCCAAAATGCCCATAAAAATAGGTGGATGGAAACGTAGCTATTGTTGGGCGAACAATCAATTTAGTGTGGAAAATGTACTCTGACAATCTTGGAAAACTCTTTGCTGACAGTGTATTTGTTTTGTTTCTACAGGTTCGCAGCCC
A/T AAATTGTGCGACGGATTTTCACGAACAGTCGCGAGCGCTGGCGACAGCAGAATGTGAACGGTGCCTTCGCAGAGCTGCGCAAGCTCATCCCAACACACCCTCCTGACAAGAAACTCAGCAAGAACGAGATCCTGCGTCTGGCCATGAAGTACATCAACTTTCTGGCTAAGCTCCTCAACGACCAGGACGACATGGTCGGCGGTGAAGCTCCCGCCCGGGCCAATCGGGACAGCAGAGATGCAACTCTAGTGCGGGACGACCTCCTTCAGGAGATGCTAAGCCCCAACTCCAGCTGCGGGAGTCTGCTGGATGGGGATGCCAGCCCAGAGAGCTTTACTGAGGACCAGGACTCATCAGTGGAGTCCAGGCCCTCTGCAAGAGGACTACACCATTCCAGCCTACCGCTGGACGGAAATGCCCAGCGGTGACTGATTGGAGACACTGACAGACTAATTTCTCGGGCTGACAACTAGCGTATGTTCATGTTGTGTGCAAGCATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations