Genomic Feature

fh229

ID
ZDB-ALT-061129-16
Name
fh229
Synonyms
  • smnY262stop (1)
  • T6044A (1)
  • Y260* (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
adult males treated with ENU
Lab of Origin
Moens Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 43799596 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
This is a T-to-A mutation resulting in a stop codon at amino acid 262.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
at position 262 (1)
Sequences
Flanking Sequence
CCCATACTGAATGTAACCCCAAACCATAACTTTTTCCTTTACCAAACTTGACTGATTTCTGTGAGAATCTTGGATCCATGCAGGTTCCTTTAGGTCTTCTGCAGTATTTGTGATGTTTGGGATTCAGTTCAACAAATAATTCATCTGAAGAATTAACCCTCTGGCACTTTTCCAAATGATCAACTAGAAGTCAAATAATTATTTGTTGCTCTTACAACAGGGATCGATGAGAAGACTTTTGTCAGGAAGTGAACACATCTACTCAACCCAAACCCTCCCTATATCTAGAAATTCAAATTTAACAGTGATCCATGTGAAATTATGAGACTGAAAAAAAACAAACCGTTGGGTTTTTATTTCCGATGCGATTTCTTGGATGCAGCAGCCTCTTTACGGCCCTGTCTTAAACCCTGTTTAAAAAATAAATAATTAAGTAAAAAGTGAAAACAGCAGGTAGACAAAGAGATGCTTGTAAATTACAAGAAAAACAACTGTACCAT
A/T TAGTATCCAGTGTGATAGCCGCTCATATACCAGGAAATCAGCATACTGCCCAAAGCCTCGTCGTCCTCCCCAAAGTCTGGACTCATAGGTGGCGGTGGTGGGATCATCTGCACCAGTTTATCACCATTACAAATAATAAACTCATCTCACTGTCTGTAAAGCTTTGACCGCACTCTAAAATGTTGGGTGGGTGATGTAACCCAATATGGAGTAAAATAATGGACAAACGTTATATAATAACATTTAAATGACACTTTATAACCCAATGACTGTGTTTGTTCATATTTGGCCCACAAGAGTGAAGGTCCGGCCATCCATCCTGTATAATGGATTTTGTCAAACCCTTCTGTACTGTTCAAATTTACAACCCTTTTGTTGTGTTTATGGCTGTTTTTGCCATATTGACTTTCTTTATAACAACATTTTTTGATTGCAAAGCCATATAATCATGCATTCTTTATTGTTGGTTCCTCCCTGTTGGGAGGAGGCAAAATGTGTAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
fh229.pdf
Citations