Genomic Feature

b963

ID
ZDB-ALT-060822-4
Name
b963
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Kimmel Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 7: 14005251 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Met>Lys at position 1 (1)
Sequences
Flanking Sequence
TTACTCTTCAGCCGTTTGCATTTCCCGTGGTCATAAAAGCTCCTTCCCTGTCATCTGACAGCGGAATACCGTGAGTGATTGACAGCTAATATGAACCAATATAACGGCAGATAAGAGCGATTCAGCACGTTTTTACAAAATATCAAAACAGGTCGCACTACAACCATTATCTGCAGTCGCACTAATGCGCCCAATTATATTATGAGGTCGCATAGATTAATTTTCGGGCGCATATGCGACCAAAATGGTCGCAATTTCGAGCCCTGAGTTAGTCAGTTCCACACTTAAATCTCATCTGTGATTCATATTCTTCCGTCTAGTAACTCAAATGACTCATTATCGTCTCTTTCTCTCTCCCCCAGGTGATTCCTGAAGTACATCTCTCTTACACGGCTCCAACTCTACATGTGCCGGGAGCAGCGCGGATTTAGCGGCCTGCTGTGCTGACGGACTTGGTGACATTAGGAATTCCTGCCTTGGTTCTCCTATAGTGTGTCTGA
T/A GGATCTCAGGCTTGCCTCATTGACGCTCGGTACACTACTGGTTCTCCTGACCTCTGGGCCACAGCCATCCATTGGACAGAAGGTTTACACCAACACATGGGCCGTCCATATTGAGGGGGGAGAGGAGGAAGCTGACCGGATTGCTAGAAAGCATAGCTTTGTGAACCATGGGAATGTGAGTACTAGCAAAGTCCCTTTACGGCATAGGTCTCAAACTTGATTCCTGGAGAGCCGCAGCTCTGCACATTTTTGCTCCATCCCTAATCAAACACAGTTGATCCAACTAATCAAGGTGTTCAAGACTACTAGAGACTATTAAGCAGGTGTGAGTTGGAGCAGCTTGAAGCTAAGCTATGCAGAGCTGCGGCCCTCAAGGTATTCAGTTTGAGTCCGTTGGTTTACAGGAAGTCATTTCACTCGGTGGCCATCTTTGTAACGCCAGTATGCTCAGGCATTCTGTTTGAATGGGGAAACCTCAAATTCTCCAAAACTCCTAGCCA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations