Genomic Feature

nt7

ID
ZDB-ALT-031030-2
Name
nt7
Synonyms
  • arl (1)
  • arrested lens (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
University of Notre Dame Center for Zebrafish Research
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 24: 41703297 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Trp>Stop at position 99 (1)
Sequences
Flanking Sequence
AACATCACCAAAGGGGAGTCAACTTGCCTAGAGTGTGTTGCCTCTGTTGATTTTTTGGAACATTTTCAATGCATTTTTCTAAAATTTGCTCAAACACAGAGAAAGTTGTGGCCAATGTAAGACTCCAAATCCCCAAATGTGCTGCCTTAGTCCCTGGTTAGACTTTATATACAACAATAAAGTAGTATAGATATCTTTAAAGTATCTGTTAAATAGTGAATCTGAGATGATGAAATATCACTACCTGCAGATTATAATATCAATATTATTGAAATGGGCTTAATTATCAGTTCTCGTTATCGATTATTAAATGATTAATATTGTGTATTCAAAATGTCAAGTCACATTTTTATTTATCATAATAACTCTGGTTTGTGCACGTCATCAATCAAGCATCAGCATGTATTTAATCTTTAGTCATTGTTGTCATTAATGTTTTATGTGCATTGAAACAGAGCAACATCCAATTACTAACGCCATTGATGGAACCAACCTGTGGT
G/A GCAGAGTCCGAGCATCAAGAACGGCCGTCAGTTCCACTGGGTCACAGTCACGCTGGACCTGCGACAGGTACCACTCTTTGTATTACAGTACAGCATGCATCAAAGTTTGGCTGAGTTTTGGGGGTGGGACTCTCTGGGTTTGTGGCCCAATAAGATGTCTTTGTGGGCGGGGCTACACATAATGGCATGTGACAAGCACAGGCCCTGTTTACACTAGTGTGTTTTAGTTTGAAAACGCATAAGTTTTGCTACGGTTACGCCATCCGTCCACACTACGCCGGAGTTTTCGAGCGCCGAAAGTGGAGCGTTTTGGAAACGCTGGAGAGGCCGTTTTCATTCTGAAACGCTGCTGCTCCGTCTCAGTGTGGATGAGGGAAAACGGAGACATCTGAAAACGGAGGTGGGGCTGCTAAGGTTCGCTACCTTATTGGAGCTTTTGTGTCATTACGTATCCTTCCCTTATTCGTCAAGCCCCTATCACATGACTATAACACATGGCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations