Genomic Feature

st9

ID
ZDB-ALT-030812-6
Name
st9
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Talbot Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 13: 50624102 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>G (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Met>Val at position 1 (1)
Sequences
Flanking Sequence
GACCGACCAGAATATTTCAGAAAATCATACATTTTTTTTGTGAGAAAAATAACATAGAGGATAAACAAACAGGTTTGGAACAAGTTAAGAATTTTCATCCCTTCTTCCAAAAATGGACAAAGTCAATCCAATGTTGGGTTGACTATTTTACATTAAATTTAAATGACATGCTAAACCAATAGTCTTGTCCATATTTTACTTGTTGGTTGGTTTTAGGTTTTCAGAGAGGATGAAGTTGAAGAAAATATACTTACAGCTTGGAGATGAGCAGTTTCTTGGCGTAACCGGAGCTGGAGTCTCTTTGCTGCTCTCCGTCTTCAGCTCAGCTTTGTTAATTTTGGGTTTTGGTTGTAAATAAACCTTGTCGTATGATGTCGGAGGTCTCGGCTGGACCACACACGGAACATGCGGCCTTGTCTTTTTCTCCGGCTCCTGGACATCCAGAACCGGCGGGTCATGAAAGCTCTGAGCAAGCCAGTCCACGGAAAAGTTCTTCACCA
T/C GATTTCACTCTATTTTTTCTCTCTCAAATTTGAGGAAGTGAATCTATCCGAGTACAATCCGAGAGTGTTCTCCAGGTCTCCAAAAGCGGCCTGATTATATAGTCCGGGCCGGCGGCGCATTAACATATGCATGGAGGAGTTAACGCCTGATCGATTCTCAATCATTAGGCCTAATGGGTCGTTATTGAAGTCTTTACATATCCTGTGATCGTGTGAAAGCCTGGCGCCAGCTTGTCTGTGAGAACCTCTGGCTCATCCAGCTGTCTGCATCCTCTTCAAACAGAGAGTCTCGGAACAACTGGATGCCGAGTGGCGCATTCATGTAAAAAAAATCACGCGTTAATAAGAGATGTTAAAAGTTTTAAGGGATGAAAATGAAAAAGGACAAGGCTAAATGATTGGTAAAACTTTTTAGAATTTTTGCTCCAATTTTTTAGCATATTCCTTATTATTAAGTCCTTGTATTTTCTTTATTTCACATCTTGACTCATATTTACAAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations